Incidental Mutation 'R8516:Zc3h12a'
ID 656134
Institutional Source Beutler Lab
Gene Symbol Zc3h12a
Ensembl Gene ENSMUSG00000042677
Gene Name zinc finger CCCH type containing 12A
Synonyms Mcpip1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.798) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 125118423-125127840 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 125119839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 411 (S411C)
Ref Sequence ENSEMBL: ENSMUSP00000037172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036188]
AlphaFold Q5D1E7
Predicted Effect probably damaging
Transcript: ENSMUST00000036188
AA Change: S411C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037172
Gene: ENSMUSG00000042677
AA Change: S411C

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 134 290 3.2e-66 PFAM
low complexity region 354 368 N/A INTRINSIC
low complexity region 476 487 N/A INTRINSIC
low complexity region 494 508 N/A INTRINSIC
low complexity region 514 544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZC3H12A is an MCP1 (CCL2; MIM 158105)-induced protein that acts as a transcriptional activator and causes cell death of cardiomyocytes, possibly via induction of genes associated with apoptosis.[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit splenomegaly, lymphadenopathy, hyperimmunoglobulinemia, increased auto-antibodies, and defective IL6 post-transcriptional regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Zc3h12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Zc3h12a APN 4 125119986 missense probably benign 0.00
IGL02419:Zc3h12a APN 4 125119788 missense probably benign
IGL03085:Zc3h12a APN 4 125127020 missense probably benign 0.19
IGL03181:Zc3h12a APN 4 125119304 missense probably damaging 1.00
I1329:Zc3h12a UTSW 4 125119364 missense possibly damaging 0.85
P0022:Zc3h12a UTSW 4 125119409 missense possibly damaging 0.69
R2084:Zc3h12a UTSW 4 125120009 missense probably benign 0.00
R2149:Zc3h12a UTSW 4 125126642 missense possibly damaging 0.77
R2404:Zc3h12a UTSW 4 125119523 missense probably damaging 1.00
R3862:Zc3h12a UTSW 4 125126939 missense probably benign
R3891:Zc3h12a UTSW 4 125126885 missense probably damaging 1.00
R4707:Zc3h12a UTSW 4 125120893 missense probably damaging 1.00
R5215:Zc3h12a UTSW 4 125126913 missense probably benign 0.17
R5283:Zc3h12a UTSW 4 125126765 missense probably benign 0.11
R5570:Zc3h12a UTSW 4 125120373 missense probably damaging 1.00
R7972:Zc3h12a UTSW 4 125119935 missense probably benign 0.43
R8311:Zc3h12a UTSW 4 125126995 missense possibly damaging 0.95
R8872:Zc3h12a UTSW 4 125126619 missense probably damaging 1.00
R8989:Zc3h12a UTSW 4 125120950 missense probably damaging 1.00
R9428:Zc3h12a UTSW 4 125126765 missense probably benign 0.11
X0026:Zc3h12a UTSW 4 125126871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATGGCTGGTCTAAAAGG -3'
(R):5'- TCCAGTCAAGGACAAAAGTAGC -3'

Sequencing Primer
(F):5'- GGATCCATAGCTGTGATAACCTGC -3'
(R):5'- CCAGAGGCCTTCCCCTG -3'
Posted On 2020-10-20