Mutagenetix > Incidental Mutations

Incidental Mutation 'R8516:Plch2'

656136

Institutional Source

Beutler Lab

Gene Symbol

Plch2

Ensembl Gene

ENSMUSG00000029055

Gene Name

phospholipase C, eta 2

Synonyms

Plcl4, A930027K05Rik, PLCeta2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8516 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

154983115-155056784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 154986307 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1205 (H1205R)

Ref Sequence

ENSEMBL: ENSMUSP00000122704 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000176194] [ENSMUST00000186598]

AlphaFold

A2AP18

Predicted Effect

probably benign
Transcript: ENSMUST00000105631

SMART Domains

Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
low complexity region	28	45	N/A	INTRINSIC
low complexity region	96	107	N/A	INTRINSIC
PH	122	231	1.8e-6	SMART
EFh	247	275	7.29e-4	SMART
EFh	283	312	4.67e-2	SMART
Pfam:EF-hand_like	317	399	1.7e-26	PFAM
PLCXc	400	545	6.76e-76	SMART
low complexity region	559	572	N/A	INTRINSIC
low complexity region	659	676	N/A	INTRINSIC
PLCYc	707	821	1.25e-56	SMART
C2	840	948	1.66e-21	SMART
low complexity region	1088	1107	N/A	INTRINSIC
low complexity region	1227	1236	N/A	INTRINSIC
low complexity region	1356	1369	N/A	INTRINSIC
low complexity region	1421	1451	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124517

SMART Domains

Protein: ENSMUSP00000122139
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
C2	1	77	1.58e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135665

SMART Domains

Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
PH	17	126	1.8e-6	SMART
EFh	142	170	7.29e-4	SMART
EFh	178	207	4.67e-2	SMART
Pfam:EF-hand_like	212	294	2.8e-25	PFAM
PLCXc	295	440	6.76e-76	SMART
low complexity region	454	467	N/A	INTRINSIC
low complexity region	554	571	N/A	INTRINSIC
PLCYc	602	716	1.25e-56	SMART
C2	735	843	1.66e-21	SMART
low complexity region	983	1002	N/A	INTRINSIC
low complexity region	1122	1131	N/A	INTRINSIC
low complexity region	1251	1264	N/A	INTRINSIC
low complexity region	1316	1346	N/A	INTRINSIC
low complexity region	1349	1361	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139976
AA Change: H1205R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055
AA Change: H1205R

Domain	Start	End	E-Value	Type
low complexity region	28	45	N/A	INTRINSIC
low complexity region	96	107	N/A	INTRINSIC
PH	122	231	1.8e-6	SMART
EFh	247	275	7.29e-4	SMART
EFh	283	312	4.67e-2	SMART
Pfam:EF-hand_like	317	399	3.2e-27	PFAM
PLCXc	400	545	6.76e-76	SMART
low complexity region	559	572	N/A	INTRINSIC
low complexity region	659	676	N/A	INTRINSIC
PLCYc	707	821	1.25e-56	SMART
C2	840	948	1.66e-21	SMART
low complexity region	1087	1100	N/A	INTRINSIC
low complexity region	1166	1194	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175982

Predicted Effect

probably benign
Transcript: ENSMUST00000176194
AA Change: H1104R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055
AA Change: H1104R

Domain	Start	End	E-Value	Type
PH	21	130	1.8e-6	SMART
EFh	146	174	7.29e-4	SMART
EFh	182	211	4.67e-2	SMART
Pfam:EF-hand_like	216	298	1.6e-25	PFAM
PLCXc	299	444	6.76e-76	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	558	575	N/A	INTRINSIC
PLCYc	606	720	1.25e-56	SMART
C2	739	847	1.66e-21	SMART
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1065	1093	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186598
AA Change: H446R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055
AA Change: H446R

Domain	Start	End	E-Value	Type
C2	79	189	5.8e-18	SMART
low complexity region	328	341	N/A	INTRINSIC
low complexity region	407	435	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,373	S22T	probably benign	Het
Actr8	G	T	14: 29,990,899	A500S	probably benign	Het
Adamtsl1	A	G	4: 86,342,543	Y1005C	probably damaging	Het
Ank3	T	A	10: 69,927,729	Y884*	probably null	Het
Arhgap28	T	C	17: 67,873,073	R306G	probably benign	Het
Atp8a2	A	C	14: 59,691,472	I1044M	probably benign	Het
Bahd1	A	G	2: 118,916,971	Y357C	probably benign	Het
Btd	A	T	14: 31,666,867	T182S	probably damaging	Het
Casc3	C	T	11: 98,822,781	R280C	probably damaging	Het
Cisd2	T	C	3: 135,411,013	T106A	probably damaging	Het
Cldn15	G	T	5: 136,974,696	C184F	probably damaging	Het
Clk4	G	A	11: 51,275,261	R198Q	probably damaging	Het
Coprs	G	T	8: 13,885,065	F163L	probably damaging	Het
Csmd3	G	A	15: 47,629,365	R2216*	probably null	Het
Defb7	A	T	8: 19,497,607	I43F	possibly damaging	Het
Dpp8	C	A	9: 65,078,009	T783K	probably damaging	Het
Eif2s1	G	A	12: 78,881,162	G204D	probably damaging	Het
Elavl4	T	C	4: 110,251,379	N56S	probably damaging	Het
Emilin1	G	A	5: 30,917,171	R252H	probably damaging	Het
Exd1	A	T	2: 119,520,073	L569Q	probably damaging	Het
Gm498	T	A	7: 143,897,274	I342N	probably damaging	Het
Gpn2	C	T	4: 133,584,831	R125C	probably damaging	Het
Gria2	T	C	3: 80,706,987	E582G	probably benign	Het
Hadha	A	T	5: 30,126,584	V458E	probably damaging	Het
Hap1	T	C	11: 100,356,067	K4R	possibly damaging	Het
Hectd4	A	T	5: 121,349,010	H3356L	possibly damaging	Het
Herc2	G	A	7: 56,206,570	V3919I	probably benign	Het
Lgr6	G	T	1: 135,075,283	N76K	probably damaging	Het
Olfr692	A	G	7: 105,368,769	I148V	probably benign	Het
P4ha3	A	G	7: 100,314,662	M462V	probably damaging	Het
Pde3b	A	T	7: 114,526,849	M773L	probably benign	Het
Peak1	T	C	9: 56,260,000	S215G	probably damaging	Het
Pgm5	T	A	19: 24,815,710	M331L	probably benign	Het
Piwil2	A	G	14: 70,420,739	V213A	probably benign	Het
Pop4	A	T	7: 38,267,402	M85K	probably benign	Het
Ppp3ca	T	A	3: 136,877,768	I212N	probably damaging	Het
Prom1	T	C	5: 44,007,099	K714R	probably benign	Het
Psip1	C	T	4: 83,466,715	G207S	probably benign	Het
Rgs22	A	G	15: 36,010,335	*1259Q	probably null	Het
Scn1a	C	T	2: 66,326,134	G477D	possibly damaging	Het
Sf3b1	T	C	1: 55,012,103	E222G	probably null	Het
Snrpa1	G	A	7: 66,070,633	G195R	probably benign	Het
Spem2	T	C	11: 69,816,895	R415G	possibly damaging	Het
Tmem167	T	A	13: 90,098,396	V13E	probably damaging	Het
Trim2	C	T	3: 84,208,320	A102T	probably damaging	Het
Trim30b	A	G	7: 104,357,404	S82P	probably benign	Het
Uba6	A	C	5: 86,127,748	S760R	possibly damaging	Het
Upf2	T	C	2: 6,018,971	F711L	unknown	Het
Utrn	T	A	10: 12,486,510	D2693V	probably damaging	Het
Vmn1r30	T	G	6: 58,435,124	Y241S	probably damaging	Het
Vmn2r110	A	G	17: 20,574,613	L598P	probably damaging	Het
Wfdc18	T	A	11: 83,709,158	F14Y	probably benign	Het
Wnt10b	A	T	15: 98,772,880	C256S	probably damaging	Het
Xrn1	T	A	9: 96,048,391	Y1554*	probably null	Het
Zc3h12a	T	A	4: 125,119,839	S411C	probably damaging	Het
Zfp112	G	A	7: 24,123,964	G63E	probably benign	Het
Zfp786	A	T	6: 47,820,543	L487Q	probably damaging	Het
Zfp953	T	A	13: 67,345,355	Y75F	possibly damaging	Het

Other mutations in Plch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Plch2	APN	4	155006642	missense	probably damaging	1.00
IGL02024:Plch2	APN	4	155043138	intron	probably benign
IGL02580:Plch2	APN	4	154984764	missense	probably benign	0.03
IGL03370:Plch2	APN	4	154986914	missense	probably benign	0.18
IGL03407:Plch2	APN	4	154989798	missense	probably damaging	1.00
tolerant	UTSW	4	154984635	missense	probably benign	0.01
PIT4418001:Plch2	UTSW	4	154989503	missense	probably damaging	1.00
PIT4445001:Plch2	UTSW	4	155009026	missense	probably damaging	1.00
R0117:Plch2	UTSW	4	154985358	unclassified	probably benign
R0347:Plch2	UTSW	4	154986721	missense	possibly damaging	0.91
R0361:Plch2	UTSW	4	155006711	missense	possibly damaging	0.95
R0413:Plch2	UTSW	4	155006916	critical splice donor site	probably null
R0487:Plch2	UTSW	4	155009012	missense	probably damaging	1.00
R0514:Plch2	UTSW	4	154998886	missense	probably damaging	1.00
R0734:Plch2	UTSW	4	154996283	missense	probably damaging	1.00
R0766:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1306:Plch2	UTSW	4	155007140	missense	probably damaging	1.00
R1312:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1602:Plch2	UTSW	4	154984450	missense	probably damaging	0.99
R1717:Plch2	UTSW	4	154998272	missense	probably benign
R1731:Plch2	UTSW	4	155006994	missense	possibly damaging	0.83
R1769:Plch2	UTSW	4	155000083	missense	probably damaging	1.00
R1875:Plch2	UTSW	4	154998508	missense	probably damaging	1.00
R1974:Plch2	UTSW	4	154984953	missense	possibly damaging	0.77
R2031:Plch2	UTSW	4	155043027	intron	probably benign
R2050:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R2061:Plch2	UTSW	4	155042841	intron	probably benign
R2073:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2075:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2109:Plch2	UTSW	4	154984597	missense	possibly damaging	0.92
R2126:Plch2	UTSW	4	154998999	missense	probably damaging	1.00
R2265:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2266:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2269:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2280:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2281:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2432:Plch2	UTSW	4	154986164	makesense	probably null
R2971:Plch2	UTSW	4	154990767	missense	probably benign	0.29
R3437:Plch2	UTSW	4	154991013	critical splice donor site	probably null
R3980:Plch2	UTSW	4	154984798	missense	probably benign	0.00
R4757:Plch2	UTSW	4	154996233	missense	possibly damaging	0.88
R4827:Plch2	UTSW	4	154991113	missense	probably damaging	1.00
R4828:Plch2	UTSW	4	154984635	missense	probably benign	0.01
R4869:Plch2	UTSW	4	154989428	missense	probably benign	0.28
R5020:Plch2	UTSW	4	155007083	missense	probably damaging	1.00
R5050:Plch2	UTSW	4	155043309	intron	probably benign
R5126:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R5237:Plch2	UTSW	4	155010794	missense	probably benign
R5274:Plch2	UTSW	4	154998954	missense	probably damaging	1.00
R5296:Plch2	UTSW	4	154989999	splice site	probably null
R5324:Plch2	UTSW	4	154984534	missense	probably benign
R5475:Plch2	UTSW	4	155000137	missense	probably damaging	1.00
R5494:Plch2	UTSW	4	154991122	missense	probably damaging	1.00
R5811:Plch2	UTSW	4	154992567	missense	possibly damaging	0.62
R6083:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R6092:Plch2	UTSW	4	154984372	missense	probably benign	0.02
R6253:Plch2	UTSW	4	155007101	missense	probably damaging	1.00
R6456:Plch2	UTSW	4	154993002	missense	probably damaging	1.00
R7038:Plch2	UTSW	4	154990032	splice site	probably null
R7084:Plch2	UTSW	4	154986991	missense	probably benign	0.31
R7210:Plch2	UTSW	4	155009086	missense	probably damaging	1.00
R7216:Plch2	UTSW	4	154984228	missense	probably benign
R7264:Plch2	UTSW	4	154998967	missense	probably damaging	0.98
R7291:Plch2	UTSW	4	154998472	missense	probably damaging	1.00
R7423:Plch2	UTSW	4	154983737	missense	probably damaging	1.00
R7436:Plch2	UTSW	4	154984096	missense	probably benign	0.01
R7438:Plch2	UTSW	4	155000460	missense	probably damaging	1.00
R7594:Plch2	UTSW	4	155007027	missense	probably damaging	1.00
R7663:Plch2	UTSW	4	154991162	missense	probably damaging	0.96
R7698:Plch2	UTSW	4	155002787	missense	possibly damaging	0.95
R7844:Plch2	UTSW	4	154989465	missense	probably damaging	1.00
R7939:Plch2	UTSW	4	155002778	missense	possibly damaging	0.91
R8003:Plch2	UTSW	4	155054523	missense	unknown
R8007:Plch2	UTSW	4	155002831	missense	probably damaging	1.00
R8281:Plch2	UTSW	4	155006973	missense	probably benign	0.07
R8434:Plch2	UTSW	4	154989735	missense	probably damaging	1.00
R8504:Plch2	UTSW	4	154984395	missense	probably benign	0.31
R8558:Plch2	UTSW	4	154998934	missense	probably damaging	1.00
R8722:Plch2	UTSW	4	154985403	unclassified	probably benign
R8768:Plch2	UTSW	4	154998867	missense	probably damaging	1.00
R8787:Plch2	UTSW	4	154986418	missense	probably benign	0.00
R8826:Plch2	UTSW	4	154986683	missense	probably benign	0.00
R8955:Plch2	UTSW	4	154992566	missense	probably benign	0.00
R9032:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R9085:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R9423:Plch2	UTSW	4	154986592	missense
RF014:Plch2	UTSW	4	155007120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTAAGCTGACGGACAAATG -3'
(R):5'- GACGTTGAGGGCCTTCAAAG -3'

Sequencing Primer
(F):5'- CTAAGCTGACGGACAAATGAAGCAG -3'
(R):5'- GCCCGGGTAGATTCACTG -3'

Posted On

2020-10-20