Incidental Mutation 'R8516:Uba6'
ID 656140
Institutional Source Beutler Lab
Gene Symbol Uba6
Ensembl Gene ENSMUSG00000035898
Gene Name ubiquitin-like modifier activating enzyme 6
Synonyms Ube1l2, 5730469D23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 86109287-86172803 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 86127748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 760 (S760R)
Ref Sequence ENSEMBL: ENSMUSP00000035328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039373] [ENSMUST00000113373]
AlphaFold Q8C7R4
Predicted Effect possibly damaging
Transcript: ENSMUST00000039373
AA Change: S760R

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035328
Gene: ENSMUSG00000035898
AA Change: S760R

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Pfam:ThiF 44 431 8.9e-29 PFAM
Pfam:E1_FCCH 224 293 1.7e-28 PFAM
Pfam:E1_4HB 294 362 9.8e-21 PFAM
internal_repeat_1 443 588 1.25e-6 PROSPERO
Pfam:UBA_e1_thiolCys 631 884 3.7e-80 PFAM
UBA_e1_C 921 1043 1.04e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113373
AA Change: S729R

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109000
Gene: ENSMUSG00000035898
AA Change: S729R

DomainStartEndE-ValueType
Pfam:ThiF 29 167 1.8e-16 PFAM
Pfam:ThiF 428 573 8.5e-34 PFAM
Pfam:UBA_e1_thiolCys 575 619 2.3e-22 PFAM
Pfam:UBACT 817 885 2.9e-28 PFAM
UBA_e1_C 890 1012 1.04e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of proteins with ubiquitin (UBB; MIM 191339) or ubiquitin-like proteins controls many signaling networks and requires a ubiquitin-activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin protein ligase (E3). UBE1L2 is an E1 enzyme that initiates the activation and conjugation of ubiquitin-like proteins (Jin et al., 2007 [PubMed 17597759]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in neurons exhibit decreased weight, postnatal and premature lethality and altered social behavior and neuronal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Uba6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Uba6 APN 5 86119407 missense possibly damaging 0.51
IGL01294:Uba6 APN 5 86150048 missense possibly damaging 0.67
IGL01625:Uba6 APN 5 86120529 nonsense probably null
IGL01807:Uba6 APN 5 86122411 missense probably damaging 1.00
IGL01919:Uba6 APN 5 86119386 missense probably benign 0.01
IGL02131:Uba6 APN 5 86150077 missense probably benign 0.18
IGL03107:Uba6 APN 5 86127774 splice site probably benign
R0314:Uba6 UTSW 5 86118087 missense probably damaging 0.99
R0350:Uba6 UTSW 5 86144378 missense possibly damaging 0.48
R0511:Uba6 UTSW 5 86112750 missense probably damaging 1.00
R0964:Uba6 UTSW 5 86119401 missense possibly damaging 0.47
R1086:Uba6 UTSW 5 86127719 missense probably benign 0.00
R1440:Uba6 UTSW 5 86140423 missense probably damaging 1.00
R1564:Uba6 UTSW 5 86154407 missense probably benign
R2377:Uba6 UTSW 5 86124370 missense possibly damaging 0.90
R2420:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2421:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2422:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2924:Uba6 UTSW 5 86159271 missense probably damaging 1.00
R3723:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R3724:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R4429:Uba6 UTSW 5 86120547 missense probably damaging 0.99
R4590:Uba6 UTSW 5 86112744 missense probably damaging 1.00
R4831:Uba6 UTSW 5 86131338 missense probably benign
R4908:Uba6 UTSW 5 86140434 splice site silent
R5193:Uba6 UTSW 5 86124422 missense probably benign 0.12
R5505:Uba6 UTSW 5 86120546 missense probably benign 0.09
R5560:Uba6 UTSW 5 86131260 missense probably damaging 1.00
R5586:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R5589:Uba6 UTSW 5 86122429 missense probably damaging 0.99
R5787:Uba6 UTSW 5 86112652 makesense probably null
R6255:Uba6 UTSW 5 86164765 missense probably benign 0.25
R6512:Uba6 UTSW 5 86124403 missense probably benign
R6772:Uba6 UTSW 5 86147073 critical splice donor site probably benign
R7536:Uba6 UTSW 5 86124332 missense probably benign 0.05
R7571:Uba6 UTSW 5 86147111 missense probably benign 0.02
R7609:Uba6 UTSW 5 86147075 missense probably benign 0.17
R7768:Uba6 UTSW 5 86152920 missense probably benign 0.01
R7839:Uba6 UTSW 5 86122412 splice site probably null
R7866:Uba6 UTSW 5 86172701 missense probably damaging 0.99
R7894:Uba6 UTSW 5 86118065 nonsense probably null
R8063:Uba6 UTSW 5 86152685 missense probably benign 0.29
R8276:Uba6 UTSW 5 86142650 intron probably benign
R8382:Uba6 UTSW 5 86131337 missense probably benign 0.01
R8673:Uba6 UTSW 5 86136319 missense probably damaging 1.00
R8778:Uba6 UTSW 5 86112697 missense possibly damaging 0.54
R8817:Uba6 UTSW 5 86148913 missense probably null 0.10
R8822:Uba6 UTSW 5 86147073 critical splice donor site probably benign
R8852:Uba6 UTSW 5 86141595 missense possibly damaging 0.47
R8887:Uba6 UTSW 5 86159202 critical splice donor site probably null
R9108:Uba6 UTSW 5 86135075 missense possibly damaging 0.69
R9245:Uba6 UTSW 5 86170559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTTCTGCCATTAGAATAGAGAG -3'
(R):5'- TCCTGATGACTGCTTGAATATAGTG -3'

Sequencing Primer
(F):5'- CTTAAGGCAAGTTCTAGCTCATGGC -3'
(R):5'- CAAAAGGACATTTGGTATTCCTCTTG -3'
Posted On 2020-10-20