Mutagenetix > Incidental Mutations

Incidental Mutation 'R8516:Uba6'

656140

Institutional Source

Beutler Lab

Gene Symbol

Uba6

Ensembl Gene

ENSMUSG00000035898

Gene Name

ubiquitin-like modifier activating enzyme 6

Synonyms

Ube1l2, 5730469D23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8516 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86109287-86172803 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 86127748 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 760 (S760R)

Ref Sequence

ENSEMBL: ENSMUSP00000035328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039373] [ENSMUST00000113373]

AlphaFold

Q8C7R4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039373
AA Change: S760R

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000035328
Gene: ENSMUSG00000035898
AA Change: S760R

Domain	Start	End	E-Value	Type
low complexity region	15	26	N/A	INTRINSIC
Pfam:ThiF	44	431	8.9e-29	PFAM
Pfam:E1_FCCH	224	293	1.7e-28	PFAM
Pfam:E1_4HB	294	362	9.8e-21	PFAM
internal_repeat_1	443	588	1.25e-6	PROSPERO
Pfam:UBA_e1_thiolCys	631	884	3.7e-80	PFAM
UBA_e1_C	921	1043	1.04e-49	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113373
AA Change: S729R

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109000
Gene: ENSMUSG00000035898
AA Change: S729R

Domain	Start	End	E-Value	Type
Pfam:ThiF	29	167	1.8e-16	PFAM
Pfam:ThiF	428	573	8.5e-34	PFAM
Pfam:UBA_e1_thiolCys	575	619	2.3e-22	PFAM
Pfam:UBACT	817	885	2.9e-28	PFAM
UBA_e1_C	890	1012	1.04e-49	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of proteins with ubiquitin (UBB; MIM 191339) or ubiquitin-like proteins controls many signaling networks and requires a ubiquitin-activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin protein ligase (E3). UBE1L2 is an E1 enzyme that initiates the activation and conjugation of ubiquitin-like proteins (Jin et al., 2007 [PubMed 17597759]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in neurons exhibit decreased weight, postnatal and premature lethality and altered social behavior and neuronal development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,373	S22T	probably benign	Het
Actr8	G	T	14: 29,990,899	A500S	probably benign	Het
Adamtsl1	A	G	4: 86,342,543	Y1005C	probably damaging	Het
Ank3	T	A	10: 69,927,729	Y884*	probably null	Het
Arhgap28	T	C	17: 67,873,073	R306G	probably benign	Het
Atp8a2	A	C	14: 59,691,472	I1044M	probably benign	Het
Bahd1	A	G	2: 118,916,971	Y357C	probably benign	Het
Btd	A	T	14: 31,666,867	T182S	probably damaging	Het
Casc3	C	T	11: 98,822,781	R280C	probably damaging	Het
Cisd2	T	C	3: 135,411,013	T106A	probably damaging	Het
Cldn15	G	T	5: 136,974,696	C184F	probably damaging	Het
Clk4	G	A	11: 51,275,261	R198Q	probably damaging	Het
Coprs	G	T	8: 13,885,065	F163L	probably damaging	Het
Csmd3	G	A	15: 47,629,365	R2216*	probably null	Het
Defb7	A	T	8: 19,497,607	I43F	possibly damaging	Het
Dpp8	C	A	9: 65,078,009	T783K	probably damaging	Het
Eif2s1	G	A	12: 78,881,162	G204D	probably damaging	Het
Elavl4	T	C	4: 110,251,379	N56S	probably damaging	Het
Emilin1	G	A	5: 30,917,171	R252H	probably damaging	Het
Exd1	A	T	2: 119,520,073	L569Q	probably damaging	Het
Gm498	T	A	7: 143,897,274	I342N	probably damaging	Het
Gpn2	C	T	4: 133,584,831	R125C	probably damaging	Het
Gria2	T	C	3: 80,706,987	E582G	probably benign	Het
Hadha	A	T	5: 30,126,584	V458E	probably damaging	Het
Hap1	T	C	11: 100,356,067	K4R	possibly damaging	Het
Hectd4	A	T	5: 121,349,010	H3356L	possibly damaging	Het
Herc2	G	A	7: 56,206,570	V3919I	probably benign	Het
Lgr6	G	T	1: 135,075,283	N76K	probably damaging	Het
Olfr692	A	G	7: 105,368,769	I148V	probably benign	Het
P4ha3	A	G	7: 100,314,662	M462V	probably damaging	Het
Pde3b	A	T	7: 114,526,849	M773L	probably benign	Het
Peak1	T	C	9: 56,260,000	S215G	probably damaging	Het
Pgm5	T	A	19: 24,815,710	M331L	probably benign	Het
Piwil2	A	G	14: 70,420,739	V213A	probably benign	Het
Plch2	T	C	4: 154,986,307	H1205R	probably benign	Het
Pop4	A	T	7: 38,267,402	M85K	probably benign	Het
Ppp3ca	T	A	3: 136,877,768	I212N	probably damaging	Het
Prom1	T	C	5: 44,007,099	K714R	probably benign	Het
Psip1	C	T	4: 83,466,715	G207S	probably benign	Het
Rgs22	A	G	15: 36,010,335	*1259Q	probably null	Het
Scn1a	C	T	2: 66,326,134	G477D	possibly damaging	Het
Sf3b1	T	C	1: 55,012,103	E222G	probably null	Het
Snrpa1	G	A	7: 66,070,633	G195R	probably benign	Het
Spem2	T	C	11: 69,816,895	R415G	possibly damaging	Het
Tmem167	T	A	13: 90,098,396	V13E	probably damaging	Het
Trim2	C	T	3: 84,208,320	A102T	probably damaging	Het
Trim30b	A	G	7: 104,357,404	S82P	probably benign	Het
Upf2	T	C	2: 6,018,971	F711L	unknown	Het
Utrn	T	A	10: 12,486,510	D2693V	probably damaging	Het
Vmn1r30	T	G	6: 58,435,124	Y241S	probably damaging	Het
Vmn2r110	A	G	17: 20,574,613	L598P	probably damaging	Het
Wfdc18	T	A	11: 83,709,158	F14Y	probably benign	Het
Wnt10b	A	T	15: 98,772,880	C256S	probably damaging	Het
Xrn1	T	A	9: 96,048,391	Y1554*	probably null	Het
Zc3h12a	T	A	4: 125,119,839	S411C	probably damaging	Het
Zfp112	G	A	7: 24,123,964	G63E	probably benign	Het
Zfp786	A	T	6: 47,820,543	L487Q	probably damaging	Het
Zfp953	T	A	13: 67,345,355	Y75F	possibly damaging	Het

Other mutations in Uba6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00555:Uba6	APN	5	86119407	missense	possibly damaging	0.51
IGL01294:Uba6	APN	5	86150048	missense	possibly damaging	0.67
IGL01625:Uba6	APN	5	86120529	nonsense	probably null
IGL01807:Uba6	APN	5	86122411	missense	probably damaging	1.00
IGL01919:Uba6	APN	5	86119386	missense	probably benign	0.01
IGL02131:Uba6	APN	5	86150077	missense	probably benign	0.18
IGL03107:Uba6	APN	5	86127774	splice site	probably benign
R0314:Uba6	UTSW	5	86118087	missense	probably damaging	0.99
R0350:Uba6	UTSW	5	86144378	missense	possibly damaging	0.48
R0511:Uba6	UTSW	5	86112750	missense	probably damaging	1.00
R0964:Uba6	UTSW	5	86119401	missense	possibly damaging	0.47
R1086:Uba6	UTSW	5	86127719	missense	probably benign	0.00
R1440:Uba6	UTSW	5	86140423	missense	probably damaging	1.00
R1564:Uba6	UTSW	5	86154407	missense	probably benign
R2377:Uba6	UTSW	5	86124370	missense	possibly damaging	0.90
R2420:Uba6	UTSW	5	86132616	critical splice donor site	probably null
R2421:Uba6	UTSW	5	86132616	critical splice donor site	probably null
R2422:Uba6	UTSW	5	86132616	critical splice donor site	probably null
R2924:Uba6	UTSW	5	86159271	missense	probably damaging	1.00
R3723:Uba6	UTSW	5	86135047	missense	probably damaging	1.00
R3724:Uba6	UTSW	5	86135047	missense	probably damaging	1.00
R4429:Uba6	UTSW	5	86120547	missense	probably damaging	0.99
R4590:Uba6	UTSW	5	86112744	missense	probably damaging	1.00
R4831:Uba6	UTSW	5	86131338	missense	probably benign
R4908:Uba6	UTSW	5	86140434	splice site	silent
R5193:Uba6	UTSW	5	86124422	missense	probably benign	0.12
R5505:Uba6	UTSW	5	86120546	missense	probably benign	0.09
R5560:Uba6	UTSW	5	86131260	missense	probably damaging	1.00
R5586:Uba6	UTSW	5	86135047	missense	probably damaging	1.00
R5589:Uba6	UTSW	5	86122429	missense	probably damaging	0.99
R5787:Uba6	UTSW	5	86112652	makesense	probably null
R6255:Uba6	UTSW	5	86164765	missense	probably benign	0.25
R6512:Uba6	UTSW	5	86124403	missense	probably benign
R6772:Uba6	UTSW	5	86147073	critical splice donor site	probably benign
R7536:Uba6	UTSW	5	86124332	missense	probably benign	0.05
R7571:Uba6	UTSW	5	86147111	missense	probably benign	0.02
R7609:Uba6	UTSW	5	86147075	missense	probably benign	0.17
R7768:Uba6	UTSW	5	86152920	missense	probably benign	0.01
R7839:Uba6	UTSW	5	86122412	splice site	probably null
R7866:Uba6	UTSW	5	86172701	missense	probably damaging	0.99
R7894:Uba6	UTSW	5	86118065	nonsense	probably null
R8063:Uba6	UTSW	5	86152685	missense	probably benign	0.29
R8276:Uba6	UTSW	5	86142650	intron	probably benign
R8382:Uba6	UTSW	5	86131337	missense	probably benign	0.01
R8673:Uba6	UTSW	5	86136319	missense	probably damaging	1.00
R8778:Uba6	UTSW	5	86112697	missense	possibly damaging	0.54
R8817:Uba6	UTSW	5	86148913	missense	probably null	0.10
R8822:Uba6	UTSW	5	86147073	critical splice donor site	probably benign
R8852:Uba6	UTSW	5	86141595	missense	possibly damaging	0.47
R8887:Uba6	UTSW	5	86159202	critical splice donor site	probably null
R9108:Uba6	UTSW	5	86135075	missense	possibly damaging	0.69
R9245:Uba6	UTSW	5	86170559	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAACTTCTGCCATTAGAATAGAGAG -3'
(R):5'- TCCTGATGACTGCTTGAATATAGTG -3'

Sequencing Primer
(F):5'- CTTAAGGCAAGTTCTAGCTCATGGC -3'
(R):5'- CAAAAGGACATTTGGTATTCCTCTTG -3'

Posted On

2020-10-20