Incidental Mutation 'R8516:Zfp112'
ID 656145
Institutional Source Beutler Lab
Gene Symbol Zfp112
Ensembl Gene ENSMUSG00000052675
Gene Name zinc finger protein 112
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_021307; MGI: 1929115

Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 24112314-24127952 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24123964 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 63 (G63E)
Ref Sequence ENSEMBL: ENSMUSP00000005413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005413] [ENSMUST00000120006] [ENSMUST00000215113]
AlphaFold Q0VAW7
Predicted Effect probably benign
Transcript: ENSMUST00000005413
AA Change: G63E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005413
Gene: ENSMUSG00000052675
AA Change: G63E

DomainStartEndE-ValueType
KRAB 8 68 7.93e-27 SMART
low complexity region 385 397 N/A INTRINSIC
ZnF_C2H2 523 545 4.11e-2 SMART
ZnF_C2H2 551 573 3.44e-4 SMART
ZnF_C2H2 579 601 1.6e-4 SMART
ZnF_C2H2 607 629 1.5e-4 SMART
ZnF_C2H2 635 657 3.89e-3 SMART
ZnF_C2H2 663 685 1.58e-3 SMART
ZnF_C2H2 691 713 6.42e-4 SMART
ZnF_C2H2 719 741 5.99e-4 SMART
ZnF_C2H2 747 769 7.78e-3 SMART
ZnF_C2H2 775 797 3.95e-4 SMART
ZnF_C2H2 803 825 2.01e-5 SMART
ZnF_C2H2 831 853 1.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120006
AA Change: G57E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113031
Gene: ENSMUSG00000052675
AA Change: G57E

DomainStartEndE-ValueType
KRAB 2 62 7.93e-27 SMART
low complexity region 379 391 N/A INTRINSIC
ZnF_C2H2 517 539 4.11e-2 SMART
ZnF_C2H2 545 567 3.44e-4 SMART
ZnF_C2H2 573 595 1.6e-4 SMART
ZnF_C2H2 601 623 1.5e-4 SMART
ZnF_C2H2 629 651 3.89e-3 SMART
ZnF_C2H2 657 679 1.58e-3 SMART
ZnF_C2H2 685 707 6.42e-4 SMART
ZnF_C2H2 713 735 5.99e-4 SMART
ZnF_C2H2 741 763 7.78e-3 SMART
ZnF_C2H2 769 791 3.95e-4 SMART
ZnF_C2H2 797 819 2.01e-5 SMART
ZnF_C2H2 825 847 1.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215113
AA Change: G63E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Zfp112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Zfp112 APN 7 24122243 missense probably damaging 1.00
IGL00575:Zfp112 APN 7 24126332 missense probably damaging 1.00
IGL00944:Zfp112 APN 7 24125596 missense probably benign 0.02
IGL01662:Zfp112 APN 7 24125954 missense probably benign 0.44
IGL03383:Zfp112 APN 7 24125678 missense probably damaging 1.00
2107:Zfp112 UTSW 7 24126841 missense probably damaging 1.00
FR4737:Zfp112 UTSW 7 24125407 small insertion probably benign
R0566:Zfp112 UTSW 7 24125677 missense probably benign 0.09
R0581:Zfp112 UTSW 7 24125863 missense probably damaging 0.97
R0613:Zfp112 UTSW 7 24127028 missense probably benign 0.33
R1521:Zfp112 UTSW 7 24125785 missense probably damaging 0.97
R1614:Zfp112 UTSW 7 24126599 missense probably damaging 1.00
R1827:Zfp112 UTSW 7 24124960 missense probably damaging 1.00
R1906:Zfp112 UTSW 7 24122295 missense probably benign 0.34
R1920:Zfp112 UTSW 7 24125237 missense probably benign 0.01
R2008:Zfp112 UTSW 7 24126751 missense probably damaging 1.00
R2012:Zfp112 UTSW 7 24125300 missense possibly damaging 0.69
R2192:Zfp112 UTSW 7 24125438 missense probably damaging 0.98
R2985:Zfp112 UTSW 7 24122295 missense probably benign 0.34
R4191:Zfp112 UTSW 7 24126143 missense probably benign 0.19
R4373:Zfp112 UTSW 7 24125048 missense probably damaging 0.99
R4374:Zfp112 UTSW 7 24126373 missense probably damaging 1.00
R4674:Zfp112 UTSW 7 24126974 missense probably damaging 1.00
R4676:Zfp112 UTSW 7 24126260 missense probably damaging 0.97
R5023:Zfp112 UTSW 7 24126484 missense probably damaging 0.99
R5198:Zfp112 UTSW 7 24124856 missense possibly damaging 0.49
R6559:Zfp112 UTSW 7 24126463 nonsense probably null
R6835:Zfp112 UTSW 7 24125806 missense probably damaging 1.00
R6946:Zfp112 UTSW 7 24125341 missense probably damaging 0.98
R7263:Zfp112 UTSW 7 24125527 missense probably benign 0.04
R7512:Zfp112 UTSW 7 24125179 missense possibly damaging 0.73
R7533:Zfp112 UTSW 7 24125327 missense possibly damaging 0.58
R7535:Zfp112 UTSW 7 24126710 missense probably damaging 1.00
R8179:Zfp112 UTSW 7 24125638 missense probably benign 0.10
R8525:Zfp112 UTSW 7 24125897 missense probably benign 0.38
R8701:Zfp112 UTSW 7 24125740 missense probably damaging 1.00
R8756:Zfp112 UTSW 7 24125572 missense probably benign 0.03
R8853:Zfp112 UTSW 7 24123965 synonymous silent
R8994:Zfp112 UTSW 7 24126065 missense probably benign 0.06
R9295:Zfp112 UTSW 7 24125380 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGAACCATCTCTCCGGCT -3'
(R):5'- CGGGCTCTAGGAAAGGAACAC -3'

Sequencing Primer
(F):5'- AGGCTAGACTGTCTCAGACTTACTG -3'
(R):5'- AACACGGGTCCTCAGGCTTG -3'
Posted On 2020-10-20