Incidental Mutation 'R0372:Snrnp40'
ID 65615
Institutional Source Beutler Lab
Gene Symbol Snrnp40
Ensembl Gene ENSMUSG00000074088
Gene Name small nuclear ribonucleoprotein 40 (U5)
Synonyms 0610009C03Rik, Wdr57
MMRRC Submission 038578-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0372 (G1)
Quality Score 211
Status Validated
Chromosome 4
Chromosomal Location 130360132-130390026 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to G at 130378043 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105994]
AlphaFold Q6PE01
Predicted Effect probably null
Transcript: ENSMUST00000105994
SMART Domains Protein: ENSMUSP00000101616
Gene: ENSMUSG00000074088

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
WD40 56 95 1.64e-9 SMART
WD40 99 138 1.83e-7 SMART
WD40 141 181 8.68e-9 SMART
WD40 184 222 3.81e-5 SMART
WD40 225 264 3.24e-8 SMART
WD40 271 314 5.1e-6 SMART
WD40 317 356 2.84e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180577
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the U5 small nuclear ribonucleoprotein (snRNP) particle. The U5 snRNP is part of the spliceosome, a multiprotein complex that catalyzes the removal of introns from pre-messenger RNAs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik T A 14: 63,973,482 Q99L probably damaging Het
Abca2 A G 2: 25,437,353 Y641C probably damaging Het
Abhd10 A G 16: 45,736,891 probably null Het
Acan G T 7: 79,100,601 A1707S probably benign Het
Ankrd61 T A 5: 143,891,175 R284S probably benign Het
Ap3d1 T C 10: 80,723,567 K258E probably damaging Het
Arl6ip6 T G 2: 53,202,921 F153V probably damaging Het
Atp2c2 C A 8: 119,757,441 F930L probably benign Het
Avl9 T C 6: 56,726,324 probably null Het
Axin2 A G 11: 108,923,333 S16G probably damaging Het
Axin2 T A 11: 108,924,110 probably benign Het
Bbs7 A T 3: 36,602,832 D282E probably benign Het
Ccny A T 18: 9,345,201 V191D probably damaging Het
Cdk11b A G 4: 155,641,500 probably benign Het
Chd1 T A 17: 17,387,290 C367S probably benign Het
Cnnm4 G A 1: 36,498,010 V472M probably damaging Het
Cpb2 T A 14: 75,242,377 I8N probably benign Het
Dusp11 A G 6: 85,958,730 probably benign Het
Elmo1 T C 13: 20,572,459 probably null Het
Gbf1 C T 19: 46,285,704 P1726S probably benign Het
Hal A G 10: 93,507,553 probably benign Het
Hlcs T C 16: 94,138,907 I671V possibly damaging Het
Ifnab A G 4: 88,690,834 S132P probably benign Het
Ing5 T C 1: 93,812,420 I70T probably damaging Het
Ints1 T C 5: 139,772,438 N228S probably damaging Het
Itgb6 T A 2: 60,627,841 I523F probably benign Het
Kat2b T C 17: 53,638,537 F328S possibly damaging Het
Kbtbd3 A T 9: 4,316,950 I34F possibly damaging Het
Klhl11 A T 11: 100,463,522 I491N probably damaging Het
Lmo7 A T 14: 101,918,053 probably benign Het
Lrp1 G T 10: 127,592,136 P523T probably damaging Het
Lrp1b T A 2: 40,730,798 D3556V probably benign Het
Lrp2 T A 2: 69,535,043 H262L probably benign Het
Lrrc27 T A 7: 139,226,187 I256K probably benign Het
Lrrc47 G A 4: 154,019,632 R523K probably benign Het
Lrrc71 A T 3: 87,745,777 S111T probably benign Het
Map3k7cl T C 16: 87,581,212 V72A probably damaging Het
Mphosph10 G T 7: 64,388,855 probably benign Het
Nlrp4a T C 7: 26,449,232 probably benign Het
Nsd2 A T 5: 33,891,551 M1140L probably damaging Het
Nt5dc3 T C 10: 86,825,291 M440T possibly damaging Het
Olfr183 T C 16: 59,000,087 V134A probably benign Het
Oog4 A T 4: 143,437,689 L424Q probably damaging Het
Orc5 A T 5: 22,533,784 Y160N possibly damaging Het
Papola T C 12: 105,818,838 F410L probably benign Het
Pcdh10 A G 3: 45,379,497 E82G probably damaging Het
Pcdh20 T C 14: 88,469,003 Y287C probably damaging Het
Pld1 T A 3: 28,088,638 probably null Het
Plekha8 G A 6: 54,616,758 probably null Het
Ppbp C T 5: 90,769,343 T93M possibly damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rab3gap2 C T 1: 185,262,694 T810M possibly damaging Het
Rassf9 A G 10: 102,546,011 N418S possibly damaging Het
Rnf20 C G 4: 49,650,176 R582G possibly damaging Het
Serpine2 T C 1: 79,821,430 I36V probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc24a2 A T 4: 87,227,292 V175E probably damaging Het
Sned1 T C 1: 93,285,951 probably benign Het
Spg11 GCC G 2: 122,059,447 probably null Het
Tecrl C T 5: 83,294,659 C189Y probably damaging Het
Tert A G 13: 73,648,991 D1116G probably damaging Het
Thnsl2 T C 6: 71,139,790 Y126C probably damaging Het
Tll2 T C 19: 41,183,313 probably null Het
Ubqln4 C T 3: 88,555,969 S147L probably benign Het
Ugt2b5 A T 5: 87,140,258 C17S probably benign Het
Vps41 A T 13: 18,842,247 Q505L probably benign Het
Zfp386 T C 12: 116,054,816 M35T possibly damaging Het
Zfp777 T C 6: 48,044,476 M71V possibly damaging Het
Zfp938 A T 10: 82,227,828 L34Q probably damaging Het
Zfp974 A T 7: 27,920,695 probably null Het
Other mutations in Snrnp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Snrnp40 APN 4 130360221 missense probably damaging 0.99
IGL02306:Snrnp40 APN 4 130365100 missense probably benign 0.21
skywarp UTSW 4 130378043 splice site probably null
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0077:Snrnp40 UTSW 4 130378043 splice site probably null
R0134:Snrnp40 UTSW 4 130378043 splice site probably null
R0211:Snrnp40 UTSW 4 130378043 splice site probably null
R0349:Snrnp40 UTSW 4 130378043 splice site probably null
R0371:Snrnp40 UTSW 4 130378043 splice site probably null
R0376:Snrnp40 UTSW 4 130378043 splice site probably null
R0377:Snrnp40 UTSW 4 130378043 splice site probably null
R0400:Snrnp40 UTSW 4 130362650 missense probably damaging 1.00
R0442:Snrnp40 UTSW 4 130378043 splice site probably null
R0443:Snrnp40 UTSW 4 130378043 splice site probably null
R0486:Snrnp40 UTSW 4 130378043 splice site probably null
R0488:Snrnp40 UTSW 4 130378043 splice site probably null
R0568:Snrnp40 UTSW 4 130378043 splice site probably null
R0624:Snrnp40 UTSW 4 130362658 missense probably damaging 0.98
R0632:Snrnp40 UTSW 4 130378043 splice site probably null
R0650:Snrnp40 UTSW 4 130378043 splice site probably null
R0733:Snrnp40 UTSW 4 130378043 splice site probably null
R1161:Snrnp40 UTSW 4 130378043 splice site probably null
R1182:Snrnp40 UTSW 4 130378043 splice site probably null
R1234:Snrnp40 UTSW 4 130378043 splice site probably null
R1236:Snrnp40 UTSW 4 130378043 splice site probably null
R1305:Snrnp40 UTSW 4 130378043 splice site probably null
R1308:Snrnp40 UTSW 4 130378043 splice site probably null
R1333:Snrnp40 UTSW 4 130378043 splice site probably null
R1413:Snrnp40 UTSW 4 130378043 splice site probably null
R1569:Snrnp40 UTSW 4 130378043 splice site probably null
R1616:Snrnp40 UTSW 4 130378043 splice site probably null
R1656:Snrnp40 UTSW 4 130378043 splice site probably null
R1675:Snrnp40 UTSW 4 130378043 splice site probably null
R1759:Snrnp40 UTSW 4 130378043 splice site probably null
R1856:Snrnp40 UTSW 4 130378043 splice site probably null
R1901:Snrnp40 UTSW 4 130385975 missense probably damaging 0.98
R1912:Snrnp40 UTSW 4 130378043 splice site probably null
R1930:Snrnp40 UTSW 4 130378043 splice site probably null
R1931:Snrnp40 UTSW 4 130378043 splice site probably null
R2435:Snrnp40 UTSW 4 130384551 missense probably damaging 1.00
R3722:Snrnp40 UTSW 4 130368275 missense possibly damaging 0.76
R4782:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R4799:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R5075:Snrnp40 UTSW 4 130388582 missense probably benign 0.07
R5104:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R5369:Snrnp40 UTSW 4 130362646 missense probably damaging 0.97
R5699:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R7529:Snrnp40 UTSW 4 130384482 missense possibly damaging 0.94
R8264:Snrnp40 UTSW 4 130378074 missense probably benign 0.00
R8412:Snrnp40 UTSW 4 130384523 missense possibly damaging 0.49
R9319:Snrnp40 UTSW 4 130362752 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACATGGTCCTCTTTCTTGAACAACCAG -3'
(R):5'- GCATTAAGTGCCAACCTCCTGCAATC -3'

Sequencing Primer
(F):5'- GAAACCAGAAGAGGGAGTCAG -3'
(R):5'- TCCTGCAATCTCAACATTTAAAAAAG -3'
Posted On 2013-08-08