Incidental Mutation 'R8516:Trim30b'
ID 656150
Institutional Source Beutler Lab
Gene Symbol Trim30b
Ensembl Gene ENSMUSG00000052749
Gene Name tripartite motif-containing 30B
Synonyms Trim30-1, A530023O14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 104355382-104369884 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104357404 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 82 (S82P)
Ref Sequence ENSEMBL: ENSMUSP00000131288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059037] [ENSMUST00000106831] [ENSMUST00000130139] [ENSMUST00000164410] [ENSMUST00000171830]
AlphaFold E9PVL6
Predicted Effect probably benign
Transcript: ENSMUST00000059037
SMART Domains Protein: ENSMUSP00000060100
Gene: ENSMUSG00000057143

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Pfam:SPRY 351 493 8.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106831
SMART Domains Protein: ENSMUSP00000102444
Gene: ENSMUSG00000052749

DomainStartEndE-ValueType
RING 15 59 4.37e-10 SMART
BBOX 92 133 2.82e-13 SMART
coiled coil region 138 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130139
SMART Domains Protein: ENSMUSP00000116775
Gene: ENSMUSG00000057143

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164410
SMART Domains Protein: ENSMUSP00000131747
Gene: ENSMUSG00000052749

DomainStartEndE-ValueType
RING 15 59 4.37e-10 SMART
BBOX 92 133 2.82e-13 SMART
coiled coil region 138 171 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171830
AA Change: S82P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131288
Gene: ENSMUSG00000052749
AA Change: S82P

DomainStartEndE-ValueType
PDB:3UV9|A 1 132 5e-9 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Trim30b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Trim30b APN 7 104366051 nonsense probably null
IGL02262:Trim30b APN 7 104365900 missense probably damaging 0.99
IGL03297:Trim30b APN 7 104365895 missense probably benign 0.40
R0078:Trim30b UTSW 7 104365895 missense probably benign 0.40
R0416:Trim30b UTSW 7 104363766 missense probably benign 0.08
R0511:Trim30b UTSW 7 104365803 missense possibly damaging 0.91
R0555:Trim30b UTSW 7 104357298 missense possibly damaging 0.73
R0609:Trim30b UTSW 7 104357976 start gained probably benign
R1317:Trim30b UTSW 7 104357335 missense possibly damaging 0.90
R1318:Trim30b UTSW 7 104357335 missense possibly damaging 0.90
R1528:Trim30b UTSW 7 104357299 missense possibly damaging 0.73
R1603:Trim30b UTSW 7 104365812 missense possibly damaging 0.70
R3859:Trim30b UTSW 7 104357280 missense probably benign 0.00
R4052:Trim30b UTSW 7 104357478 missense possibly damaging 0.64
R4576:Trim30b UTSW 7 104357331 missense possibly damaging 0.75
R4577:Trim30b UTSW 7 104357331 missense possibly damaging 0.75
R4578:Trim30b UTSW 7 104357331 missense possibly damaging 0.75
R5705:Trim30b UTSW 7 104357577 missense probably damaging 1.00
R5753:Trim30b UTSW 7 104357337 missense possibly damaging 0.89
R5846:Trim30b UTSW 7 104357371 missense possibly damaging 0.94
R5914:Trim30b UTSW 7 104357365 missense probably damaging 0.98
R6083:Trim30b UTSW 7 104366142 missense probably damaging 0.98
R6862:Trim30b UTSW 7 104363753 missense probably damaging 0.98
R7216:Trim30b UTSW 7 104357362 missense probably benign 0.22
R8062:Trim30b UTSW 7 104366186 start gained probably benign
R8552:Trim30b UTSW 7 104366029 missense probably benign 0.01
R8824:Trim30b UTSW 7 104357906 start gained probably benign
Z1088:Trim30b UTSW 7 104366100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATTGACCGTATCAGGGAAGG -3'
(R):5'- CCAACTATTGGCACAGGGGAAC -3'

Sequencing Primer
(F):5'- TGAAAGCTTCATAGGTAGAAACATC -3'
(R):5'- CAATACCTGGAAGTAGACATGTCTAG -3'
Posted On 2020-10-20