Incidental Mutation 'R8516:Pde3b'
ID 656152
Institutional Source Beutler Lab
Gene Symbol Pde3b
Ensembl Gene ENSMUSG00000030671
Gene Name phosphodiesterase 3B, cGMP-inhibited
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 114415281-114539251 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114526849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 773 (M773L)
Ref Sequence ENSEMBL: ENSMUSP00000032909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032909]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032909
AA Change: M773L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032909
Gene: ENSMUSG00000030671
AA Change: M773L

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
transmembrane domain 73 90 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 171 190 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
HDc 710 927 7.52e-4 SMART
low complexity region 991 1023 N/A INTRINSIC
low complexity region 1048 1067 N/A INTRINSIC
low complexity region 1081 1096 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutants show abnormalities in glycerol and fatty acid levels, along with changes in adipocyte morphology and decreased body fat percentage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Pde3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Pde3b APN 7 114518410 missense probably benign 0.00
IGL01637:Pde3b APN 7 114526901 nonsense probably null
IGL02004:Pde3b APN 7 114519617 missense possibly damaging 0.67
IGL02113:Pde3b APN 7 114526906 missense probably damaging 1.00
IGL02201:Pde3b APN 7 114534608 missense probably damaging 1.00
IGL02266:Pde3b APN 7 114526966 missense probably damaging 1.00
IGL02601:Pde3b APN 7 114523342 missense probably damaging 1.00
IGL02641:Pde3b APN 7 114530817 missense probably damaging 1.00
IGL02671:Pde3b APN 7 114523345 missense possibly damaging 0.77
IGL02691:Pde3b APN 7 114508085 splice site probably benign
IGL02719:Pde3b APN 7 114506248 missense probably damaging 1.00
IGL03092:Pde3b APN 7 114523348 missense probably damaging 1.00
FR4342:Pde3b UTSW 7 114534775 small insertion probably benign
R0208:Pde3b UTSW 7 114497981 missense probably benign 0.00
R1191:Pde3b UTSW 7 114519575 missense probably benign 0.01
R1514:Pde3b UTSW 7 114530766 missense probably damaging 0.98
R1612:Pde3b UTSW 7 114519556 nonsense probably null
R2081:Pde3b UTSW 7 114523422 missense probably benign
R2433:Pde3b UTSW 7 114526837 missense probably benign 0.30
R2508:Pde3b UTSW 7 114526857 nonsense probably null
R3842:Pde3b UTSW 7 114526867 missense probably damaging 1.00
R4082:Pde3b UTSW 7 114494588 missense probably benign 0.04
R4115:Pde3b UTSW 7 114521727 missense probably damaging 1.00
R4197:Pde3b UTSW 7 114530872 splice site probably benign
R4236:Pde3b UTSW 7 114521688 missense possibly damaging 0.62
R4355:Pde3b UTSW 7 114416287 missense probably benign
R4411:Pde3b UTSW 7 114534749 small deletion probably benign
R4430:Pde3b UTSW 7 114534670 missense probably damaging 1.00
R4901:Pde3b UTSW 7 114508190 missense probably damaging 0.99
R4969:Pde3b UTSW 7 114519612 missense possibly damaging 0.92
R5314:Pde3b UTSW 7 114494537 missense probably damaging 1.00
R5346:Pde3b UTSW 7 114506190 missense probably benign 0.00
R5706:Pde3b UTSW 7 114521692 missense probably damaging 1.00
R5844:Pde3b UTSW 7 114508871 missense probably benign 0.01
R6014:Pde3b UTSW 7 114416440 missense probably damaging 1.00
R6048:Pde3b UTSW 7 114508267 missense probably benign 0.00
R6190:Pde3b UTSW 7 114523032 splice site probably null
R7220:Pde3b UTSW 7 114536062 missense probably damaging 0.97
R7239:Pde3b UTSW 7 114416149 missense probably damaging 0.99
R7818:Pde3b UTSW 7 114491440 missense probably damaging 0.99
R7869:Pde3b UTSW 7 114494687 missense probably benign 0.03
R8443:Pde3b UTSW 7 114526894 missense probably damaging 0.99
R8483:Pde3b UTSW 7 114519568 missense probably benign 0.15
R8754:Pde3b UTSW 7 114416043 missense possibly damaging 0.90
R9017:Pde3b UTSW 7 114416460 nonsense probably null
R9221:Pde3b UTSW 7 114415462 start gained probably benign
R9302:Pde3b UTSW 7 114523386 missense probably damaging 1.00
RF051:Pde3b UTSW 7 114534775 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTCAGAATTCTCTAATGTCCTGC -3'
(R):5'- AGCATTCATCATCATGTGCTTTCAC -3'

Sequencing Primer
(F):5'- TGTCCTGCAAGATAAACAATGGG -3'
(R):5'- CAGATTATAGAGTGATATGCAATCGG -3'
Posted On 2020-10-20