Incidental Mutation 'R8516:Gm498'
ID 656153
Institutional Source Beutler Lab
Gene Symbol Gm498
Ensembl Gene ENSMUSG00000031085
Gene Name predicted gene 498
Synonyms LOC244239
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 143866838-143900046 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 143897274 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 342 (I342N)
Ref Sequence ENSEMBL: ENSMUSP00000115809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134455] [ENSMUST00000152910] [ENSMUST00000179036] [ENSMUST00000207235] [ENSMUST00000207482] [ENSMUST00000207630] [ENSMUST00000207642] [ENSMUST00000208038] [ENSMUST00000208153] [ENSMUST00000208457] [ENSMUST00000208625] [ENSMUST00000208761]
AlphaFold D3YYH9
Predicted Effect probably benign
Transcript: ENSMUST00000134455
Predicted Effect probably damaging
Transcript: ENSMUST00000152910
AA Change: I342N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115809
Gene: ENSMUSG00000031085
AA Change: I342N

DomainStartEndE-ValueType
ACTIN 3 372 1.94e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179036
SMART Domains Protein: ENSMUSP00000137404
Gene: ENSMUSG00000031085

DomainStartEndE-ValueType
ACTIN 5 330 1.4e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207235
Predicted Effect probably benign
Transcript: ENSMUST00000207482
Predicted Effect probably damaging
Transcript: ENSMUST00000207630
AA Change: I340N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000207642
Predicted Effect probably benign
Transcript: ENSMUST00000208038
Predicted Effect probably benign
Transcript: ENSMUST00000208153
Predicted Effect probably benign
Transcript: ENSMUST00000208457
Predicted Effect probably benign
Transcript: ENSMUST00000208625
Predicted Effect probably benign
Transcript: ENSMUST00000208761
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Gm498
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02202:Gm498 APN 7 143894173 missense possibly damaging 0.71
R0128:Gm498 UTSW 7 143891755 missense probably damaging 1.00
R0217:Gm498 UTSW 7 143894219 splice site probably benign
R0726:Gm498 UTSW 7 143871761 missense probably damaging 0.99
R1025:Gm498 UTSW 7 143896390 missense probably damaging 0.99
R2879:Gm498 UTSW 7 143894063 nonsense probably null
R2925:Gm498 UTSW 7 143883999 nonsense probably null
R3625:Gm498 UTSW 7 143871854 missense possibly damaging 0.71
R4003:Gm498 UTSW 7 143897303 missense probably benign 0.16
R4184:Gm498 UTSW 7 143894121 nonsense probably null
R4205:Gm498 UTSW 7 143869227 missense probably damaging 0.99
R6179:Gm498 UTSW 7 143871787 missense probably benign 0.12
R7170:Gm498 UTSW 7 143896365 missense probably damaging 0.97
R8023:Gm498 UTSW 7 143891791 missense probably damaging 0.97
R8109:Gm498 UTSW 7 143897466 splice site probably null
R8120:Gm498 UTSW 7 143871787 missense probably benign 0.12
R8309:Gm498 UTSW 7 143883943 missense possibly damaging 0.95
R8748:Gm498 UTSW 7 143891819 missense probably benign
R8944:Gm498 UTSW 7 143881165 critical splice acceptor site probably null
R8964:Gm498 UTSW 7 143869293 missense probably benign
R9220:Gm498 UTSW 7 143881165 critical splice acceptor site probably null
R9221:Gm498 UTSW 7 143881165 critical splice acceptor site probably null
R9222:Gm498 UTSW 7 143881165 critical splice acceptor site probably null
R9303:Gm498 UTSW 7 143881165 critical splice acceptor site probably null
R9304:Gm498 UTSW 7 143881165 critical splice acceptor site probably null
R9306:Gm498 UTSW 7 143881165 critical splice acceptor site probably null
R9307:Gm498 UTSW 7 143881165 critical splice acceptor site probably null
R9308:Gm498 UTSW 7 143881165 critical splice acceptor site probably null
R9428:Gm498 UTSW 7 143881165 critical splice acceptor site probably null
R9429:Gm498 UTSW 7 143881165 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCATCATGGCATCAAGGATG -3'
(R):5'- TATGCCCTGCTCAGTATGGC -3'

Sequencing Primer
(F):5'- GCCTCCTGAGTATTAGAATCACAGG -3'
(R):5'- CTGCTCAGTATGGCTAAGGC -3'
Posted On 2020-10-20