Incidental Mutation 'R8516:Coprs'
ID 656154
Institutional Source Beutler Lab
Gene Symbol Coprs
Ensembl Gene ENSMUSG00000031458
Gene Name coordinator of PRMT5, differentiation stimulator
Synonyms COPR5, MGC11316, 1700029I03Rik, 2410022L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 13884794-13890281 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 13885065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 163 (F163L)
Ref Sequence ENSEMBL: ENSMUSP00000033839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033839] [ENSMUST00000051870] [ENSMUST00000128557] [ENSMUST00000209371]
AlphaFold Q9CQ13
Predicted Effect probably damaging
Transcript: ENSMUST00000033839
AA Change: F163L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033839
Gene: ENSMUSG00000031458
AA Change: F163L

DomainStartEndE-ValueType
Pfam:COPR5 24 173 1.3e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051870
SMART Domains Protein: ENSMUSP00000057270
Gene: ENSMUSG00000047710

DomainStartEndE-ValueType
ZnF_C2H2 14 37 1.62e0 SMART
ZnF_C2H2 62 85 2.29e1 SMART
internal_repeat_1 109 278 1.19e-9 PROSPERO
low complexity region 298 318 N/A INTRINSIC
low complexity region 354 368 N/A INTRINSIC
internal_repeat_1 373 534 1.19e-9 PROSPERO
low complexity region 602 613 N/A INTRINSIC
low complexity region 677 690 N/A INTRINSIC
ZnF_C2H2 699 722 2.68e1 SMART
ZnF_C2H2 728 750 1.79e-2 SMART
ZnF_C2H2 755 776 2.23e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128557
SMART Domains Protein: ENSMUSP00000120117
Gene: ENSMUSG00000047710

DomainStartEndE-ValueType
ZnF_C2H2 14 37 1.62e0 SMART
ZnF_C2H2 62 85 2.29e1 SMART
internal_repeat_1 109 278 5.23e-7 PROSPERO
low complexity region 298 318 N/A INTRINSIC
low complexity region 354 368 N/A INTRINSIC
internal_repeat_1 373 534 5.23e-7 PROSPERO
low complexity region 602 613 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209371
AA Change: F70L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced retroperitoneal white adipose tissue with fewer and larger adipocytes. In vitro adipogenic conversion of embryoid bodies and primary embryonic fibroblasts is markedly delayed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Coprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02445:Coprs APN 8 13885797 missense possibly damaging 0.94
IGL02947:Coprs APN 8 13885782 missense probably damaging 0.98
R1669:Coprs UTSW 8 13885704 nonsense probably null
R1874:Coprs UTSW 8 13885112 missense probably damaging 1.00
R6974:Coprs UTSW 8 13885750 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCCCCAGTTAATGCCTGTC -3'
(R):5'- CATGCCCAAGAATATGTGTGTCTTC -3'

Sequencing Primer
(F):5'- TGTCTATAGCCCACACTGAGGAG -3'
(R):5'- TCTGTGCAGTCCAGTTTGAC -3'
Posted On 2020-10-20