Incidental Mutation 'R8516:Xrn1'
ID 656159
Institutional Source Beutler Lab
Gene Symbol Xrn1
Ensembl Gene ENSMUSG00000032410
Gene Name 5'-3' exoribonuclease 1
Synonyms Dhm2, mXrn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 95954760-96057803 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 96048391 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1554 (Y1554*)
Ref Sequence ENSEMBL: ENSMUSP00000034981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034981] [ENSMUST00000185633]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000034981
AA Change: Y1554*
SMART Domains Protein: ENSMUSP00000034981
Gene: ENSMUSG00000032410
AA Change: Y1554*

DomainStartEndE-ValueType
Pfam:XRN_N 1 227 8.4e-99 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 1054 1066 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1665 1684 N/A INTRINSIC
low complexity region 1696 1711 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185633
AA Change: Y1550*
SMART Domains Protein: ENSMUSP00000140278
Gene: ENSMUSG00000032410
AA Change: Y1550*

DomainStartEndE-ValueType
Pfam:XRN_N 1 228 1.2e-103 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 1054 1066 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1661 1680 N/A INTRINSIC
low complexity region 1692 1707 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 5'-3' exonuclease family. The encoded protein may be involved in replication-dependent histone mRNA degradation, and interacts directly with the enhancer of mRNA-decapping protein 4. In addition to mRNA metabolism, a similar protein in yeast has been implicated in a variety of nuclear and cytoplasmic functions, including homologous recombination, meiosis, telomere maintenance, and microtubule assembly. Mutations in this gene are associated with osteosarcoma, suggesting that the encoded protein may also play a role in bone formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Xrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Xrn1 APN 9 96038949 missense probably benign 0.05
IGL00778:Xrn1 APN 9 95973447 splice site probably benign
IGL01936:Xrn1 APN 9 96048344 missense probably damaging 0.98
IGL01983:Xrn1 APN 9 95973368 critical splice donor site probably null
IGL02106:Xrn1 APN 9 95977805 missense probably benign 0.28
IGL02330:Xrn1 APN 9 95973348 nonsense probably null
IGL02338:Xrn1 APN 9 95977827 missense probably benign 0.42
IGL02830:Xrn1 APN 9 96018181 critical splice donor site probably null
R0063:Xrn1 UTSW 9 95969535 missense probably damaging 1.00
R0063:Xrn1 UTSW 9 95969535 missense probably damaging 1.00
R0467:Xrn1 UTSW 9 96024191 missense probably damaging 1.00
R0508:Xrn1 UTSW 9 96051736 missense probably benign 0.00
R0605:Xrn1 UTSW 9 96026877 nonsense probably null
R0670:Xrn1 UTSW 9 95991056 missense probably damaging 1.00
R0691:Xrn1 UTSW 9 95973539 missense probably damaging 0.96
R0781:Xrn1 UTSW 9 95991269 missense probably benign 0.00
R0947:Xrn1 UTSW 9 95998263 missense possibly damaging 0.60
R1034:Xrn1 UTSW 9 96039737 missense probably damaging 1.00
R1124:Xrn1 UTSW 9 96003865 missense probably benign 0.02
R1171:Xrn1 UTSW 9 95991011 missense possibly damaging 0.47
R1199:Xrn1 UTSW 9 95981761 splice site probably benign
R1609:Xrn1 UTSW 9 95974893 missense probably benign 0.03
R1921:Xrn1 UTSW 9 95999497 missense probably benign 0.04
R1953:Xrn1 UTSW 9 96024221 critical splice donor site probably null
R2000:Xrn1 UTSW 9 96045563 nonsense probably null
R2109:Xrn1 UTSW 9 95979220 missense probably benign 0.13
R2111:Xrn1 UTSW 9 96039832 missense probably benign 0.03
R2164:Xrn1 UTSW 9 96006820 missense possibly damaging 0.95
R2266:Xrn1 UTSW 9 96006712 missense possibly damaging 0.64
R3754:Xrn1 UTSW 9 95967788 missense probably damaging 1.00
R3783:Xrn1 UTSW 9 95969285 missense probably benign 0.10
R3921:Xrn1 UTSW 9 95969284 missense probably benign 0.01
R3929:Xrn1 UTSW 9 95988873 missense possibly damaging 0.89
R4011:Xrn1 UTSW 9 95985225 nonsense probably null
R4082:Xrn1 UTSW 9 95981920 missense probably benign 0.02
R4455:Xrn1 UTSW 9 95973645 intron probably benign
R4736:Xrn1 UTSW 9 96033636 missense probably damaging 1.00
R4756:Xrn1 UTSW 9 96039809 missense probably benign 0.00
R4780:Xrn1 UTSW 9 95974744 intron probably benign
R5152:Xrn1 UTSW 9 95964065 missense probably benign 0.40
R5261:Xrn1 UTSW 9 96045543 missense probably benign 0.00
R5741:Xrn1 UTSW 9 96045551 missense probably benign 0.24
R6108:Xrn1 UTSW 9 95974427 missense possibly damaging 0.91
R6127:Xrn1 UTSW 9 95969489 missense probably damaging 0.99
R6268:Xrn1 UTSW 9 95964014 missense probably damaging 1.00
R6418:Xrn1 UTSW 9 96033710 splice site probably null
R7002:Xrn1 UTSW 9 96047790 missense probably benign 0.00
R7067:Xrn1 UTSW 9 95969512 missense probably damaging 0.98
R7155:Xrn1 UTSW 9 95979145 missense possibly damaging 0.92
R7439:Xrn1 UTSW 9 96051629 missense probably benign
R7447:Xrn1 UTSW 9 96045494 missense probably benign
R7454:Xrn1 UTSW 9 96048358 missense probably benign 0.03
R7473:Xrn1 UTSW 9 95979141 missense probably benign 0.07
R7561:Xrn1 UTSW 9 95999458 missense probably benign 0.18
R7580:Xrn1 UTSW 9 96011679 missense not run
R7642:Xrn1 UTSW 9 96021853 missense possibly damaging 0.95
R7763:Xrn1 UTSW 9 95998348 critical splice donor site probably null
R8225:Xrn1 UTSW 9 96035667 missense probably benign
R8372:Xrn1 UTSW 9 96024113 missense probably benign 0.42
R8710:Xrn1 UTSW 9 96002232 missense
R8850:Xrn1 UTSW 9 96038679 missense probably benign
R8865:Xrn1 UTSW 9 95991193 missense probably benign 0.00
R8951:Xrn1 UTSW 9 95988946 missense probably benign 0.00
R9013:Xrn1 UTSW 9 96038928 missense probably benign 0.00
R9162:Xrn1 UTSW 9 96033607 missense probably benign 0.01
R9163:Xrn1 UTSW 9 95998221 missense probably benign 0.00
R9415:Xrn1 UTSW 9 95969474 missense probably damaging 1.00
R9438:Xrn1 UTSW 9 96011234 missense probably benign 0.30
Z1176:Xrn1 UTSW 9 95964190 missense probably damaging 1.00
Z1177:Xrn1 UTSW 9 95991005 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTACTGGTACATGGGCCACAG -3'
(R):5'- TGATGTACGCTTGTGCACAC -3'

Sequencing Primer
(F):5'- AGATGTTGTGAGCTGCCCTACAC -3'
(R):5'- ACCTTACCAGTAGGTTGG -3'
Posted On 2020-10-20