Incidental Mutation 'R8516:Clk4'
ID 656162
Institutional Source Beutler Lab
Gene Symbol Clk4
Ensembl Gene ENSMUSG00000020385
Gene Name CDC like kinase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 51261730-51281766 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 51275261 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 198 (R198Q)
Ref Sequence ENSEMBL: ENSMUSP00000090820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093132] [ENSMUST00000109111] [ENSMUST00000109113] [ENSMUST00000126131] [ENSMUST00000130641] [ENSMUST00000148053] [ENSMUST00000153414]
AlphaFold O35493
Predicted Effect probably damaging
Transcript: ENSMUST00000093132
AA Change: R198Q

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090820
Gene: ENSMUSG00000020385
AA Change: R198Q

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
S_TKc 159 475 1.58e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109111
AA Change: R18Q

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104739
Gene: ENSMUSG00000020385
AA Change: R18Q

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 225 3.3e-20 PFAM
Pfam:Pkinase 1 295 5.4e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109113
AA Change: R18Q

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104741
Gene: ENSMUSG00000020385
AA Change: R18Q

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 225 3.3e-20 PFAM
Pfam:Pkinase 1 295 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126131
SMART Domains Protein: ENSMUSP00000118972
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130641
SMART Domains Protein: ENSMUSP00000123133
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 105 122 N/A INTRINSIC
low complexity region 126 141 N/A INTRINSIC
PDB:2VAG|A 149 182 2e-14 PDB
SCOP:d1howa_ 149 182 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148053
SMART Domains Protein: ENSMUSP00000120822
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153414
SMART Domains Protein: ENSMUSP00000115894
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDC2-like protein kinase (CLK) family. This protein kinase can interact with and phosphorylate the serine- and arginine-rich (SR) proteins, which are known to play an important role in the formation of spliceosomes, and thus may be involved in the regulation of alternative splicing. Studies in the Israeli sand rat Psammomys obesus suggested that the ubiquitin-like 5 (UBL5/BEACON), a highly conserved ubiquitin-like protein, may interact with and regulate the activity of this kinase. Multiple alternatively spliced transcript variants have been observed, but the full-length natures of which have not yet been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Clk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Clk4 APN 11 51281172 nonsense probably null
B6819:Clk4 UTSW 11 51275766 unclassified probably benign
K7894:Clk4 UTSW 11 51275766 unclassified probably benign
R0001:Clk4 UTSW 11 51268765 splice site probably benign
R0466:Clk4 UTSW 11 51267328 missense possibly damaging 0.59
R0692:Clk4 UTSW 11 51281328 nonsense probably null
R0719:Clk4 UTSW 11 51275493 nonsense probably null
R0723:Clk4 UTSW 11 51275493 nonsense probably null
R1277:Clk4 UTSW 11 51267189 missense probably benign
R1714:Clk4 UTSW 11 51280418 missense probably damaging 1.00
R4804:Clk4 UTSW 11 51281323 missense probably damaging 1.00
R5141:Clk4 UTSW 11 51275771 missense possibly damaging 0.79
R5399:Clk4 UTSW 11 51275257 missense probably damaging 1.00
R6182:Clk4 UTSW 11 51268182 missense possibly damaging 0.66
R6274:Clk4 UTSW 11 51271921 missense possibly damaging 0.69
R6480:Clk4 UTSW 11 51270546 nonsense probably null
R6759:Clk4 UTSW 11 51275574 missense possibly damaging 0.95
R6843:Clk4 UTSW 11 51276249 critical splice donor site probably null
R7138:Clk4 UTSW 11 51277932 missense probably damaging 1.00
R7186:Clk4 UTSW 11 51268780 missense probably benign 0.00
R7235:Clk4 UTSW 11 51276185 missense probably damaging 0.98
R7687:Clk4 UTSW 11 51281398 missense probably benign 0.02
R7842:Clk4 UTSW 11 51281129 missense probably benign 0.00
R8073:Clk4 UTSW 11 51277889 missense probably benign 0.29
R8515:Clk4 UTSW 11 51275261 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTGGAACCTAATATTATGGGCTC -3'
(R):5'- TCTAGCATCTGGACGCATCG -3'

Sequencing Primer
(F):5'- CTGAGGTAGGACTTTCACAAGTTCAG -3'
(R):5'- CATCTGGACGCATCGGCTAAAAG -3'
Posted On 2020-10-20