Mutagenetix > Incidental Mutation

Incidental Mutation 'R8516:Casc3'

656165

Institutional Source

Beutler Lab

Gene Symbol

Casc3

Ensembl Gene

ENSMUSG00000078676

Gene Name

cancer susceptibility candidate 3

Synonyms

Btz, Mln51

MMRRC Submission

067848-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R8516 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98804905-98833814 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 98822781 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 280 (R280C)

Ref Sequence

ENSEMBL: ENSMUSP00000130926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]

AlphaFold

Q8K3W3

Predicted Effect

probably damaging
Transcript: ENSMUST00000017384
AA Change: R280C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: R280C

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169695
AA Change: R280C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: R280C

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,373	S22T	probably benign	Het
Actr8	G	T	14: 29,990,899	A500S	probably benign	Het
Adamtsl1	A	G	4: 86,342,543	Y1005C	probably damaging	Het
Ank3	T	A	10: 69,927,729	Y884*	probably null	Het
Arhgap28	T	C	17: 67,873,073	R306G	probably benign	Het
Atp8a2	A	C	14: 59,691,472	I1044M	probably benign	Het
Bahd1	A	G	2: 118,916,971	Y357C	probably benign	Het
Btd	A	T	14: 31,666,867	T182S	probably damaging	Het
Cisd2	T	C	3: 135,411,013	T106A	probably damaging	Het
Cldn15	G	T	5: 136,974,696	C184F	probably damaging	Het
Clk4	G	A	11: 51,275,261	R198Q	probably damaging	Het
Coprs	G	T	8: 13,885,065	F163L	probably damaging	Het
Csmd3	G	A	15: 47,629,365	R2216*	probably null	Het
Defb7	A	T	8: 19,497,607	I43F	possibly damaging	Het
Dpp8	C	A	9: 65,078,009	T783K	probably damaging	Het
Eif2s1	G	A	12: 78,881,162	G204D	probably damaging	Het
Elavl4	T	C	4: 110,251,379	N56S	probably damaging	Het
Emilin1	G	A	5: 30,917,171	R252H	probably damaging	Het
Exd1	A	T	2: 119,520,073	L569Q	probably damaging	Het
Gm498	T	A	7: 143,897,274	I342N	probably damaging	Het
Gpn2	C	T	4: 133,584,831	R125C	probably damaging	Het
Gria2	T	C	3: 80,706,987	E582G	probably benign	Het
Hadha	A	T	5: 30,126,584	V458E	probably damaging	Het
Hap1	T	C	11: 100,356,067	K4R	possibly damaging	Het
Hectd4	A	T	5: 121,349,010	H3356L	possibly damaging	Het
Herc2	G	A	7: 56,206,570	V3919I	probably benign	Het
Lgr6	G	T	1: 135,075,283	N76K	probably damaging	Het
Olfr692	A	G	7: 105,368,769	I148V	probably benign	Het
P4ha3	A	G	7: 100,314,662	M462V	probably damaging	Het
Pde3b	A	T	7: 114,526,849	M773L	probably benign	Het
Peak1	T	C	9: 56,260,000	S215G	probably damaging	Het
Pgm5	T	A	19: 24,815,710	M331L	probably benign	Het
Piwil2	A	G	14: 70,420,739	V213A	probably benign	Het
Plch2	T	C	4: 154,986,307	H1205R	probably benign	Het
Pop4	A	T	7: 38,267,402	M85K	probably benign	Het
Ppp3ca	T	A	3: 136,877,768	I212N	probably damaging	Het
Prom1	T	C	5: 44,007,099	K714R	probably benign	Het
Psip1	C	T	4: 83,466,715	G207S	probably benign	Het
Rgs22	A	G	15: 36,010,335	*1259Q	probably null	Het
Scn1a	C	T	2: 66,326,134	G477D	possibly damaging	Het
Sf3b1	T	C	1: 55,012,103	E222G	probably null	Het
Snrpa1	G	A	7: 66,070,633	G195R	probably benign	Het
Spem2	T	C	11: 69,816,895	R415G	possibly damaging	Het
Tmem167	T	A	13: 90,098,396	V13E	probably damaging	Het
Trim2	C	T	3: 84,208,320	A102T	probably damaging	Het
Trim30b	A	G	7: 104,357,404	S82P	probably benign	Het
Uba6	A	C	5: 86,127,748	S760R	possibly damaging	Het
Upf2	T	C	2: 6,018,971	F711L	unknown	Het
Utrn	T	A	10: 12,486,510	D2693V	probably damaging	Het
Vmn1r30	T	G	6: 58,435,124	Y241S	probably damaging	Het
Vmn2r110	A	G	17: 20,574,613	L598P	probably damaging	Het
Wfdc18	T	A	11: 83,709,158	F14Y	probably benign	Het
Wnt10b	A	T	15: 98,772,880	C256S	probably damaging	Het
Xrn1	T	A	9: 96,048,391	Y1554*	probably null	Het
Zc3h12a	T	A	4: 125,119,839	S411C	probably damaging	Het
Zfp112	G	A	7: 24,123,964	G63E	probably benign	Het
Zfp786	A	T	6: 47,820,543	L487Q	probably damaging	Het
Zfp953	T	A	13: 67,345,355	Y75F	possibly damaging	Het

Other mutations in Casc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Casc3	APN	11	98823202	missense	possibly damaging	0.62
IGL01566:Casc3	APN	11	98823401	critical splice donor site	probably null
IGL01901:Casc3	APN	11	98823121	missense	probably damaging	1.00
IGL02345:Casc3	APN	11	98827564	splice site	probably benign
IGL02875:Casc3	APN	11	98821552	missense	probably damaging	1.00
IGL02964:Casc3	APN	11	98828923	missense	probably damaging	0.96
R0147:Casc3	UTSW	11	98822499	missense	possibly damaging	0.89
R0195:Casc3	UTSW	11	98821493	missense	probably damaging	0.99
R0763:Casc3	UTSW	11	98831318	missense	probably damaging	1.00
R1581:Casc3	UTSW	11	98822818	missense	possibly damaging	0.66
R2021:Casc3	UTSW	11	98821506	missense	probably benign	0.01
R4380:Casc3	UTSW	11	98823031	missense	possibly damaging	0.67
R4612:Casc3	UTSW	11	98822958	missense	probably benign	0.13
R4988:Casc3	UTSW	11	98821874	splice site	probably null
R5079:Casc3	UTSW	11	98810426	intron	probably benign
R5442:Casc3	UTSW	11	98821471	missense	probably damaging	0.99
R5511:Casc3	UTSW	11	98810914	nonsense	probably null
R5873:Casc3	UTSW	11	98821444	missense	unknown
R6041:Casc3	UTSW	11	98828559	missense	probably damaging	1.00
R6685:Casc3	UTSW	11	98822530	missense	probably damaging	0.99
R7030:Casc3	UTSW	11	98822533	missense	possibly damaging	0.74
R7107:Casc3	UTSW	11	98827587	missense	possibly damaging	0.93
R7594:Casc3	UTSW	11	98821485	missense	probably benign	0.04
R7659:Casc3	UTSW	11	98809873	missense	unknown
R7660:Casc3	UTSW	11	98809873	missense	unknown
R8443:Casc3	UTSW	11	98822781	missense	probably damaging	1.00
R8444:Casc3	UTSW	11	98822781	missense	probably damaging	1.00
R8491:Casc3	UTSW	11	98823151	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- GGGTTTGGAACATCTCCCTG -3'
(R):5'- TGACCGGTAACTAGCTTCATG -3'

Sequencing Primer
(F):5'- GGAACATCTCCCTGACTCCTTTGG -3'
(R):5'- GCTTCATGCTTAAGAGTCTCAGCAG -3'

Posted On

2020-10-20