Incidental Mutation 'R8516:Casc3'
ID656165
Institutional Source Beutler Lab
Gene Symbol Casc3
Ensembl Gene ENSMUSG00000078676
Gene Namecancer susceptibility candidate 3
SynonymsBtz, Mln51
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R8516 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98804905-98833814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98822781 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 280 (R280C)
Ref Sequence ENSEMBL: ENSMUSP00000130926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]
AlphaFold Q8K3W3
Predicted Effect probably damaging
Transcript: ENSMUST00000017384
AA Change: R280C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: R280C

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169695
AA Change: R280C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: R280C

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Casc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Casc3 APN 11 98823202 missense possibly damaging 0.62
IGL01566:Casc3 APN 11 98823401 critical splice donor site probably null
IGL01901:Casc3 APN 11 98823121 missense probably damaging 1.00
IGL02345:Casc3 APN 11 98827564 splice site probably benign
IGL02875:Casc3 APN 11 98821552 missense probably damaging 1.00
IGL02964:Casc3 APN 11 98828923 missense probably damaging 0.96
R0147:Casc3 UTSW 11 98822499 missense possibly damaging 0.89
R0195:Casc3 UTSW 11 98821493 missense probably damaging 0.99
R0763:Casc3 UTSW 11 98831318 missense probably damaging 1.00
R1581:Casc3 UTSW 11 98822818 missense possibly damaging 0.66
R2021:Casc3 UTSW 11 98821506 missense probably benign 0.01
R4380:Casc3 UTSW 11 98823031 missense possibly damaging 0.67
R4612:Casc3 UTSW 11 98822958 missense probably benign 0.13
R4988:Casc3 UTSW 11 98821874 splice site probably null
R5079:Casc3 UTSW 11 98810426 intron probably benign
R5442:Casc3 UTSW 11 98821471 missense probably damaging 0.99
R5511:Casc3 UTSW 11 98810914 nonsense probably null
R5873:Casc3 UTSW 11 98821444 missense unknown
R6041:Casc3 UTSW 11 98828559 missense probably damaging 1.00
R6685:Casc3 UTSW 11 98822530 missense probably damaging 0.99
R7030:Casc3 UTSW 11 98822533 missense possibly damaging 0.74
R7107:Casc3 UTSW 11 98827587 missense possibly damaging 0.93
R7594:Casc3 UTSW 11 98821485 missense probably benign 0.04
R7659:Casc3 UTSW 11 98809873 missense unknown
R7660:Casc3 UTSW 11 98809873 missense unknown
R8443:Casc3 UTSW 11 98822781 missense probably damaging 1.00
R8444:Casc3 UTSW 11 98822781 missense probably damaging 1.00
R8491:Casc3 UTSW 11 98823151 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGGTTTGGAACATCTCCCTG -3'
(R):5'- TGACCGGTAACTAGCTTCATG -3'

Sequencing Primer
(F):5'- GGAACATCTCCCTGACTCCTTTGG -3'
(R):5'- GCTTCATGCTTAAGAGTCTCAGCAG -3'
Posted On2020-10-20