Incidental Mutation 'R8516:Eif2s1'
ID 656167
Institutional Source Beutler Lab
Gene Symbol Eif2s1
Ensembl Gene ENSMUSG00000021116
Gene Name eukaryotic translation initiation factor 2, subunit 1 alpha
Synonyms eIF2alpha, 0910001O23Rik, 2410026C18Rik, Eif2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8516 (G1)
Quality Score 221.009
Status Not validated
Chromosome 12
Chromosomal Location 78861819-78887010 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78881162 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 204 (G204D)
Ref Sequence ENSEMBL: ENSMUSP00000071214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071230]
AlphaFold Q6ZWX6
Predicted Effect probably damaging
Transcript: ENSMUST00000071230
AA Change: G204D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071214
Gene: ENSMUSG00000021116
AA Change: G204D

DomainStartEndE-ValueType
S1 15 88 1.72e-12 SMART
Pfam:EIF_2_alpha 130 244 1e-40 PFAM
coiled coil region 284 310 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The translation initiation factor EIF2 catalyzes the first regulated step of protein synthesis initiation, promoting the binding of the initiator tRNA to 40S ribosomal subunits. Binding occurs as a ternary complex of methionyl-tRNA, EIF2, and GTP. EIF2 is composed of 3 nonidentical subunits, the 36-kD EIF2-alpha subunit (EIF2S1), the 38-kD EIF2-beta subunit (EIF2S2; MIM 603908), and the 52-kD EIF2-gamma subunit (EIF2S3; MIM 300161). The rate of formation of the ternary complex is modulated by the phosphorylation state of EIF2-alpha (Ernst et al., 1987 [PubMed 2948954]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knocked-in point mutation die within hours of birth and exhibit hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Eif2s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Eif2s1 APN 12 78866646 missense possibly damaging 0.92
IGL00736:Eif2s1 APN 12 78884837 unclassified probably benign
IGL02072:Eif2s1 APN 12 78880014 missense probably benign 0.04
IGL02312:Eif2s1 APN 12 78880016 missense probably damaging 1.00
IGL03379:Eif2s1 APN 12 78866580 missense probably benign 0.00
Sistine UTSW 12 78883352 missense possibly damaging 0.71
R0669:Eif2s1 UTSW 12 78881238 splice site probably benign
R1426:Eif2s1 UTSW 12 78881168 missense probably benign 0.01
R1644:Eif2s1 UTSW 12 78866521 splice site probably null
R1998:Eif2s1 UTSW 12 78866734 missense possibly damaging 0.90
R2069:Eif2s1 UTSW 12 78877185 missense probably benign 0.03
R3885:Eif2s1 UTSW 12 78881225 missense probably damaging 1.00
R4704:Eif2s1 UTSW 12 78877170 missense probably benign 0.31
R4964:Eif2s1 UTSW 12 78880011 missense probably benign
R5908:Eif2s1 UTSW 12 78880043 missense probably damaging 0.99
R6473:Eif2s1 UTSW 12 78881225 missense probably damaging 1.00
R6601:Eif2s1 UTSW 12 78883352 missense possibly damaging 0.71
R7043:Eif2s1 UTSW 12 78877108 missense probably damaging 0.99
R7358:Eif2s1 UTSW 12 78881195 missense probably damaging 1.00
R8875:Eif2s1 UTSW 12 78866687 missense probably damaging 1.00
R9236:Eif2s1 UTSW 12 78874569 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAGGTATTCTAAAAGATCTGCTGGG -3'
(R):5'- TTTTCTACCCAACATGACCAGC -3'

Sequencing Primer
(F):5'- TCAGTACTGACAGGATGGCTC -3'
(R):5'- CAACATGACCAGCCAAAAGGGG -3'
Posted On 2020-10-20