Mutagenetix > Incidental Mutations

Incidental Mutation 'R8516:Atp8a2'

656172

Institutional Source

Beutler Lab

Gene Symbol

Atp8a2

Ensembl Gene

ENSMUSG00000021983

Gene Name

ATPase, aminophospholipid transporter-like, class I, type 8A, member 2

Synonyms

wl, Ib

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.507) question?

Stock #

R8516 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59638540-60197179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 59691472 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 1044 (I1044M)

Ref Sequence

ENSEMBL: ENSMUSP00000079238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080368]

AlphaFold

P98200

Predicted Effect

probably benign
Transcript: ENSMUST00000080368
AA Change: I1044M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: I1044M

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	14	80	2.3e-27	PFAM
Pfam:E1-E2_ATPase	85	348	6.7e-15	PFAM
Pfam:HAD	385	790	3.2e-22	PFAM
Pfam:Cation_ATPase	465	564	3.2e-14	PFAM
Pfam:PhoLip_ATPase_C	807	1059	2.8e-79	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,373	S22T	probably benign	Het
Actr8	G	T	14: 29,990,899	A500S	probably benign	Het
Adamtsl1	A	G	4: 86,342,543	Y1005C	probably damaging	Het
Ank3	T	A	10: 69,927,729	Y884*	probably null	Het
Arhgap28	T	C	17: 67,873,073	R306G	probably benign	Het
Bahd1	A	G	2: 118,916,971	Y357C	probably benign	Het
Btd	A	T	14: 31,666,867	T182S	probably damaging	Het
Casc3	C	T	11: 98,822,781	R280C	probably damaging	Het
Cisd2	T	C	3: 135,411,013	T106A	probably damaging	Het
Cldn15	G	T	5: 136,974,696	C184F	probably damaging	Het
Clk4	G	A	11: 51,275,261	R198Q	probably damaging	Het
Coprs	G	T	8: 13,885,065	F163L	probably damaging	Het
Csmd3	G	A	15: 47,629,365	R2216*	probably null	Het
Defb7	A	T	8: 19,497,607	I43F	possibly damaging	Het
Dpp8	C	A	9: 65,078,009	T783K	probably damaging	Het
Eif2s1	G	A	12: 78,881,162	G204D	probably damaging	Het
Elavl4	T	C	4: 110,251,379	N56S	probably damaging	Het
Emilin1	G	A	5: 30,917,171	R252H	probably damaging	Het
Exd1	A	T	2: 119,520,073	L569Q	probably damaging	Het
Gm498	T	A	7: 143,897,274	I342N	probably damaging	Het
Gpn2	C	T	4: 133,584,831	R125C	probably damaging	Het
Gria2	T	C	3: 80,706,987	E582G	probably benign	Het
Hadha	A	T	5: 30,126,584	V458E	probably damaging	Het
Hap1	T	C	11: 100,356,067	K4R	possibly damaging	Het
Hectd4	A	T	5: 121,349,010	H3356L	possibly damaging	Het
Herc2	G	A	7: 56,206,570	V3919I	probably benign	Het
Lgr6	G	T	1: 135,075,283	N76K	probably damaging	Het
Olfr692	A	G	7: 105,368,769	I148V	probably benign	Het
P4ha3	A	G	7: 100,314,662	M462V	probably damaging	Het
Pde3b	A	T	7: 114,526,849	M773L	probably benign	Het
Peak1	T	C	9: 56,260,000	S215G	probably damaging	Het
Pgm5	T	A	19: 24,815,710	M331L	probably benign	Het
Piwil2	A	G	14: 70,420,739	V213A	probably benign	Het
Plch2	T	C	4: 154,986,307	H1205R	probably benign	Het
Pop4	A	T	7: 38,267,402	M85K	probably benign	Het
Ppp3ca	T	A	3: 136,877,768	I212N	probably damaging	Het
Prom1	T	C	5: 44,007,099	K714R	probably benign	Het
Psip1	C	T	4: 83,466,715	G207S	probably benign	Het
Rgs22	A	G	15: 36,010,335	*1259Q	probably null	Het
Scn1a	C	T	2: 66,326,134	G477D	possibly damaging	Het
Sf3b1	T	C	1: 55,012,103	E222G	probably null	Het
Snrpa1	G	A	7: 66,070,633	G195R	probably benign	Het
Spem2	T	C	11: 69,816,895	R415G	possibly damaging	Het
Tmem167	T	A	13: 90,098,396	V13E	probably damaging	Het
Trim2	C	T	3: 84,208,320	A102T	probably damaging	Het
Trim30b	A	G	7: 104,357,404	S82P	probably benign	Het
Uba6	A	C	5: 86,127,748	S760R	possibly damaging	Het
Upf2	T	C	2: 6,018,971	F711L	unknown	Het
Utrn	T	A	10: 12,486,510	D2693V	probably damaging	Het
Vmn1r30	T	G	6: 58,435,124	Y241S	probably damaging	Het
Vmn2r110	A	G	17: 20,574,613	L598P	probably damaging	Het
Wfdc18	T	A	11: 83,709,158	F14Y	probably benign	Het
Wnt10b	A	T	15: 98,772,880	C256S	probably damaging	Het
Xrn1	T	A	9: 96,048,391	Y1554*	probably null	Het
Zc3h12a	T	A	4: 125,119,839	S411C	probably damaging	Het
Zfp112	G	A	7: 24,123,964	G63E	probably benign	Het
Zfp786	A	T	6: 47,820,543	L487Q	probably damaging	Het
Zfp953	T	A	13: 67,345,355	Y75F	possibly damaging	Het

Other mutations in Atp8a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01289:Atp8a2	APN	14	59691461	missense	probably benign	0.00
IGL01505:Atp8a2	APN	14	60028063	missense	probably benign	0.00
IGL01614:Atp8a2	APN	14	60044988	missense	probably damaging	0.99
IGL01621:Atp8a2	APN	14	60015868	splice site	probably benign
IGL01634:Atp8a2	APN	14	59998062	missense	probably benign	0.01
IGL01672:Atp8a2	APN	14	59691533	missense	probably benign	0.01
IGL01898:Atp8a2	APN	14	60023513	missense	probably damaging	1.00
IGL01945:Atp8a2	APN	14	60026160	missense	probably damaging	1.00
IGL02006:Atp8a2	APN	14	59857048	missense	possibly damaging	0.90
IGL02089:Atp8a2	APN	14	60026920	splice site	probably null
IGL02211:Atp8a2	APN	14	60027976	missense	probably benign	0.00
IGL02283:Atp8a2	APN	14	60016799	missense	possibly damaging	0.86
IGL02337:Atp8a2	APN	14	59998002	missense	probably benign	0.32
IGL02571:Atp8a2	APN	14	60012458	splice site	probably benign
IGL02795:Atp8a2	APN	14	60033742	missense	probably damaging	0.96
IGL02874:Atp8a2	APN	14	59802252	missense	probably damaging	1.00
IGL02999:Atp8a2	APN	14	59925122	nonsense	probably null
IGL03307:Atp8a2	APN	14	60015872	critical splice donor site	probably null
IGL03345:Atp8a2	APN	14	59774011	missense	probably benign
PIT4431001:Atp8a2	UTSW	14	59654626	missense	probably benign
R0334:Atp8a2	UTSW	14	59691512	missense	probably damaging	1.00
R0368:Atp8a2	UTSW	14	59860212	missense	probably damaging	1.00
R0420:Atp8a2	UTSW	14	59773744	missense	probably damaging	1.00
R0684:Atp8a2	UTSW	14	60023144	missense	probably benign	0.00
R0755:Atp8a2	UTSW	14	60009881	missense	possibly damaging	0.96
R0853:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R0908:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R0991:Atp8a2	UTSW	14	59793929	missense	probably benign	0.33
R1025:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1190:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1387:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1426:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1442:Atp8a2	UTSW	14	59860323	splice site	probably benign
R1472:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1538:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1573:Atp8a2	UTSW	14	59860206	missense	probably benign	0.00
R1620:Atp8a2	UTSW	14	59791183	missense	probably benign
R1661:Atp8a2	UTSW	14	59860186	missense	possibly damaging	0.80
R1673:Atp8a2	UTSW	14	59791240	missense	probably benign	0.00
R1749:Atp8a2	UTSW	14	59860174	nonsense	probably null
R1796:Atp8a2	UTSW	14	60020758	critical splice donor site	probably null
R1815:Atp8a2	UTSW	14	60086624	missense	probably damaging	1.00
R1836:Atp8a2	UTSW	14	60006366	missense	possibly damaging	0.49
R1935:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1936:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1937:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R2416:Atp8a2	UTSW	14	59925008	missense	probably damaging	1.00
R2760:Atp8a2	UTSW	14	59860192	missense	probably benign	0.43
R3029:Atp8a2	UTSW	14	59691465	frame shift	probably null
R3621:Atp8a2	UTSW	14	60026138	splice site	probably null
R3768:Atp8a2	UTSW	14	60044336	missense	probably benign	0.19
R3784:Atp8a2	UTSW	14	59773966	missense	probably damaging	1.00
R3896:Atp8a2	UTSW	14	60026140	critical splice donor site	probably null
R4009:Atp8a2	UTSW	14	60027985	missense	possibly damaging	0.54
R4591:Atp8a2	UTSW	14	59654629	missense	probably benign	0.03
R4866:Atp8a2	UTSW	14	59691467	missense	probably damaging	1.00
R4879:Atp8a2	UTSW	14	60008469	nonsense	probably null
R5059:Atp8a2	UTSW	14	59691537	missense	probably benign	0.00
R5529:Atp8a2	UTSW	14	59793865	critical splice donor site	probably null
R5788:Atp8a2	UTSW	14	60020793	missense	probably damaging	0.96
R6126:Atp8a2	UTSW	14	60044326	missense	probably benign
R6295:Atp8a2	UTSW	14	60012399	nonsense	probably null
R6393:Atp8a2	UTSW	14	59773755	nonsense	probably null
R6454:Atp8a2	UTSW	14	60008499	splice site	probably null
R6651:Atp8a2	UTSW	14	59774021	missense	probably benign	0.00
R6763:Atp8a2	UTSW	14	60008408	missense	probably benign	0.12
R6767:Atp8a2	UTSW	14	60046722	missense	probably damaging	1.00
R6912:Atp8a2	UTSW	14	60012410	missense	probably benign	0.33
R7032:Atp8a2	UTSW	14	60017840	splice site	probably null
R7243:Atp8a2	UTSW	14	59647842	missense	probably benign
R7352:Atp8a2	UTSW	14	59791204	missense	probably benign
R7355:Atp8a2	UTSW	14	60045004	missense	possibly damaging	0.65
R7382:Atp8a2	UTSW	14	59654594	missense	probably benign	0.00
R7451:Atp8a2	UTSW	14	59791181	missense	probably null	0.00
R7483:Atp8a2	UTSW	14	60008375	missense	probably benign	0.00
R7516:Atp8a2	UTSW	14	59857067	missense	probably damaging	1.00
R7831:Atp8a2	UTSW	14	59773753	missense	probably damaging	0.99
R8116:Atp8a2	UTSW	14	60026208	missense	probably damaging	1.00
R8171:Atp8a2	UTSW	14	60046044	missense	probably damaging	1.00
R8504:Atp8a2	UTSW	14	59647917	nonsense	probably null
R8552:Atp8a2	UTSW	14	59773982	missense	probably benign	0.00
R8852:Atp8a2	UTSW	14	59925096	missense	probably damaging	1.00
R9367:Atp8a2	UTSW	14	60012378	critical splice donor site	probably null
Z1088:Atp8a2	UTSW	14	60027970	missense	probably benign
Z1177:Atp8a2	UTSW	14	60006330	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGCCCCTGTCGAATGTCATG -3'
(R):5'- ATTGCTTCCACGTTGCAGG -3'

Sequencing Primer
(F):5'- GAATGTCATGTGACCTCTGCTCAG -3'
(R):5'- GGATGCTCCACCTTGATTAAAC -3'

Posted On

2020-10-20