Incidental Mutation 'R8516:Vmn2r110'
ID 656177
Institutional Source Beutler Lab
Gene Symbol Vmn2r110
Ensembl Gene ENSMUSG00000091259
Gene Name vomeronasal 2, receptor 110
Synonyms EG224582
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20573829-20596259 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20574613 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 598 (L598P)
Ref Sequence ENSEMBL: ENSMUSP00000129347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095633] [ENSMUST00000169559]
AlphaFold E9PWD5
Predicted Effect probably benign
Transcript: ENSMUST00000095633
SMART Domains Protein: ENSMUSP00000093293
Gene: ENSMUSG00000071273

DomainStartEndE-ValueType
RRM 17 84 5.29e-5 SMART
low complexity region 101 113 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 160 175 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
RRM 207 274 1.55e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169559
AA Change: L598P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129347
Gene: ENSMUSG00000091259
AA Change: L598P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 83 467 3.1e-33 PFAM
Pfam:NCD3G 510 563 5.2e-22 PFAM
Pfam:7tm_3 594 831 4.2e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Pgm5 T A 19: 24,815,710 M331L probably benign Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Vmn2r110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01774:Vmn2r110 APN 17 20583627 missense probably benign 0.01
IGL01824:Vmn2r110 APN 17 20574667 missense probably benign 0.44
IGL01879:Vmn2r110 APN 17 20573860 missense probably benign 0.01
IGL02168:Vmn2r110 APN 17 20583800 splice site probably benign
IGL02178:Vmn2r110 APN 17 20584444 splice site probably null
IGL02322:Vmn2r110 APN 17 20573935 missense probably damaging 1.00
IGL02323:Vmn2r110 APN 17 20596137 missense probably damaging 0.98
IGL02415:Vmn2r110 APN 17 20583771 missense probably benign 0.03
IGL02491:Vmn2r110 APN 17 20596138 missense probably damaging 0.99
IGL02876:Vmn2r110 APN 17 20574296 missense probably damaging 0.98
IGL03141:Vmn2r110 APN 17 20583714 missense possibly damaging 0.79
IGL03270:Vmn2r110 APN 17 20583516 missense probably benign 0.00
IGL03286:Vmn2r110 APN 17 20584206 missense possibly damaging 0.95
IGL03379:Vmn2r110 APN 17 20583644 missense probably damaging 0.99
PIT4243001:Vmn2r110 UTSW 17 20582117 missense probably benign 0.01
R0040:Vmn2r110 UTSW 17 20596084 missense probably benign 0.10
R0195:Vmn2r110 UTSW 17 20574055 missense probably benign 0.31
R0716:Vmn2r110 UTSW 17 20573903 missense probably damaging 0.99
R1199:Vmn2r110 UTSW 17 20583263 missense probably benign 0.03
R1767:Vmn2r110 UTSW 17 20580578 missense possibly damaging 0.83
R2212:Vmn2r110 UTSW 17 20573947 splice site probably null
R3056:Vmn2r110 UTSW 17 20583098 missense probably damaging 1.00
R4093:Vmn2r110 UTSW 17 20583380 missense possibly damaging 0.83
R4418:Vmn2r110 UTSW 17 20583689 nonsense probably null
R4598:Vmn2r110 UTSW 17 20583767 nonsense probably null
R4754:Vmn2r110 UTSW 17 20596196 missense probably benign 0.00
R5283:Vmn2r110 UTSW 17 20580637 missense probably benign 0.00
R5421:Vmn2r110 UTSW 17 20583620 missense probably damaging 1.00
R5672:Vmn2r110 UTSW 17 20596232 missense probably benign
R5865:Vmn2r110 UTSW 17 20584295 missense probably benign 0.00
R6642:Vmn2r110 UTSW 17 20583517 missense possibly damaging 0.94
R6799:Vmn2r110 UTSW 17 20583536 missense probably benign
R7167:Vmn2r110 UTSW 17 20574179 missense probably benign 0.01
R7291:Vmn2r110 UTSW 17 20574209 missense probably benign 0.13
R7320:Vmn2r110 UTSW 17 20596054 missense probably benign
R7519:Vmn2r110 UTSW 17 20584262 missense probably benign
R8089:Vmn2r110 UTSW 17 20583545 missense probably benign 0.00
R8234:Vmn2r110 UTSW 17 20584429 missense probably benign 0.12
R8272:Vmn2r110 UTSW 17 20596228 missense probably damaging 0.97
R8307:Vmn2r110 UTSW 17 20583057 missense probably benign 0.00
R8506:Vmn2r110 UTSW 17 20584365 missense probably benign 0.00
R8555:Vmn2r110 UTSW 17 20584356 missense probably damaging 0.97
R8691:Vmn2r110 UTSW 17 20583142 missense probably benign 0.19
R8859:Vmn2r110 UTSW 17 20574298 missense probably damaging 0.99
R8935:Vmn2r110 UTSW 17 20583695 missense probably benign 0.40
R8986:Vmn2r110 UTSW 17 20583561 missense probably damaging 0.97
R9012:Vmn2r110 UTSW 17 20583365 missense probably damaging 1.00
R9101:Vmn2r110 UTSW 17 20574209 missense
Z1088:Vmn2r110 UTSW 17 20583680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACAGTGAATGCAACTCC -3'
(R):5'- AGATAGGGAATCAGTTCAACCTAGAC -3'

Sequencing Primer
(F):5'- CCAAATATGTTCTGCTGAAGGATGC -3'
(R):5'- GGGAATCAGTTCAACCTAGACTCATG -3'
Posted On 2020-10-20