Incidental Mutation 'R8516:Pgm5'
ID 656179
Institutional Source Beutler Lab
Gene Symbol Pgm5
Ensembl Gene ENSMUSG00000041731
Gene Name phosphoglucomutase 5
Synonyms 9530034F03Rik, aciculin
MMRRC Submission
Accession Numbers

Genbank: NM_175013

Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock # R8516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 24683016-24861855 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24815710 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 331 (M331L)
Ref Sequence ENSEMBL: ENSMUSP00000036025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047666]
AlphaFold Q8BZF8
Predicted Effect probably benign
Transcript: ENSMUST00000047666
AA Change: M331L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036025
Gene: ENSMUSG00000041731
AA Change: M331L

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 19 163 3.9e-31 PFAM
Pfam:PGM_PMM_II 198 306 1.8e-15 PFAM
Pfam:PGM_PMM_III 311 425 6.9e-31 PFAM
SCOP:d3pmga4 427 567 5e-74 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoglucomutases (EC 5.2.2.2.), such as PGM5, are phosphotransferases involved in interconversion of glucose-1-phosphate and glucose-6-phosphate. PGM activity is essential in formation of carbohydrates from glucose-6-phosphate and in formation of glucose-6-phosphate from galactose and glycogen (Edwards et al., 1995 [PubMed 8586438]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,373 S22T probably benign Het
Actr8 G T 14: 29,990,899 A500S probably benign Het
Adamtsl1 A G 4: 86,342,543 Y1005C probably damaging Het
Ank3 T A 10: 69,927,729 Y884* probably null Het
Arhgap28 T C 17: 67,873,073 R306G probably benign Het
Atp8a2 A C 14: 59,691,472 I1044M probably benign Het
Bahd1 A G 2: 118,916,971 Y357C probably benign Het
Btd A T 14: 31,666,867 T182S probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cisd2 T C 3: 135,411,013 T106A probably damaging Het
Cldn15 G T 5: 136,974,696 C184F probably damaging Het
Clk4 G A 11: 51,275,261 R198Q probably damaging Het
Coprs G T 8: 13,885,065 F163L probably damaging Het
Csmd3 G A 15: 47,629,365 R2216* probably null Het
Defb7 A T 8: 19,497,607 I43F possibly damaging Het
Dpp8 C A 9: 65,078,009 T783K probably damaging Het
Eif2s1 G A 12: 78,881,162 G204D probably damaging Het
Elavl4 T C 4: 110,251,379 N56S probably damaging Het
Emilin1 G A 5: 30,917,171 R252H probably damaging Het
Exd1 A T 2: 119,520,073 L569Q probably damaging Het
Gm498 T A 7: 143,897,274 I342N probably damaging Het
Gpn2 C T 4: 133,584,831 R125C probably damaging Het
Gria2 T C 3: 80,706,987 E582G probably benign Het
Hadha A T 5: 30,126,584 V458E probably damaging Het
Hap1 T C 11: 100,356,067 K4R possibly damaging Het
Hectd4 A T 5: 121,349,010 H3356L possibly damaging Het
Herc2 G A 7: 56,206,570 V3919I probably benign Het
Lgr6 G T 1: 135,075,283 N76K probably damaging Het
Olfr692 A G 7: 105,368,769 I148V probably benign Het
P4ha3 A G 7: 100,314,662 M462V probably damaging Het
Pde3b A T 7: 114,526,849 M773L probably benign Het
Peak1 T C 9: 56,260,000 S215G probably damaging Het
Piwil2 A G 14: 70,420,739 V213A probably benign Het
Plch2 T C 4: 154,986,307 H1205R probably benign Het
Pop4 A T 7: 38,267,402 M85K probably benign Het
Ppp3ca T A 3: 136,877,768 I212N probably damaging Het
Prom1 T C 5: 44,007,099 K714R probably benign Het
Psip1 C T 4: 83,466,715 G207S probably benign Het
Rgs22 A G 15: 36,010,335 *1259Q probably null Het
Scn1a C T 2: 66,326,134 G477D possibly damaging Het
Sf3b1 T C 1: 55,012,103 E222G probably null Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Spem2 T C 11: 69,816,895 R415G possibly damaging Het
Tmem167 T A 13: 90,098,396 V13E probably damaging Het
Trim2 C T 3: 84,208,320 A102T probably damaging Het
Trim30b A G 7: 104,357,404 S82P probably benign Het
Uba6 A C 5: 86,127,748 S760R possibly damaging Het
Upf2 T C 2: 6,018,971 F711L unknown Het
Utrn T A 10: 12,486,510 D2693V probably damaging Het
Vmn1r30 T G 6: 58,435,124 Y241S probably damaging Het
Vmn2r110 A G 17: 20,574,613 L598P probably damaging Het
Wfdc18 T A 11: 83,709,158 F14Y probably benign Het
Wnt10b A T 15: 98,772,880 C256S probably damaging Het
Xrn1 T A 9: 96,048,391 Y1554* probably null Het
Zc3h12a T A 4: 125,119,839 S411C probably damaging Het
Zfp112 G A 7: 24,123,964 G63E probably benign Het
Zfp786 A T 6: 47,820,543 L487Q probably damaging Het
Zfp953 T A 13: 67,345,355 Y75F possibly damaging Het
Other mutations in Pgm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Pgm5 APN 19 24834766 missense possibly damaging 0.65
IGL01318:Pgm5 APN 19 24816478 missense probably damaging 1.00
IGL01372:Pgm5 APN 19 24733621 missense probably damaging 1.00
IGL01541:Pgm5 APN 19 24816413 missense probably damaging 1.00
IGL01648:Pgm5 APN 19 24824351 missense probably damaging 0.99
IGL02049:Pgm5 APN 19 24824418 missense probably benign 0.00
IGL02827:Pgm5 APN 19 24709295 missense probably benign 0.16
IGL02975:Pgm5 APN 19 24834848 missense probably benign 0.00
3-1:Pgm5 UTSW 19 24727788 missense probably benign 0.02
P0047:Pgm5 UTSW 19 24816421 missense probably damaging 1.00
PIT4466001:Pgm5 UTSW 19 24824329 missense probably damaging 1.00
R0013:Pgm5 UTSW 19 24733540 critical splice donor site probably null
R0047:Pgm5 UTSW 19 24684556 missense probably damaging 0.98
R0180:Pgm5 UTSW 19 24815763 missense probably damaging 1.00
R0317:Pgm5 UTSW 19 24824399 missense possibly damaging 0.55
R0478:Pgm5 UTSW 19 24834869 missense possibly damaging 0.45
R1587:Pgm5 UTSW 19 24815749 missense probably damaging 1.00
R2017:Pgm5 UTSW 19 24824312 missense probably benign 0.06
R2087:Pgm5 UTSW 19 24733563 missense probably damaging 0.99
R2152:Pgm5 UTSW 19 24834815 missense probably damaging 1.00
R2169:Pgm5 UTSW 19 24834815 missense probably damaging 1.00
R3851:Pgm5 UTSW 19 24820203 missense probably damaging 1.00
R4034:Pgm5 UTSW 19 24861657 missense probably damaging 0.96
R4489:Pgm5 UTSW 19 24816445 missense probably benign 0.12
R4630:Pgm5 UTSW 19 24834746 nonsense probably null
R4736:Pgm5 UTSW 19 24834805 missense probably damaging 1.00
R5186:Pgm5 UTSW 19 24820128 missense probably damaging 1.00
R5414:Pgm5 UTSW 19 24709325 missense probably damaging 0.99
R5558:Pgm5 UTSW 19 24824451 splice site probably null
R5617:Pgm5 UTSW 19 24750401 nonsense probably null
R6142:Pgm5 UTSW 19 24824408 missense probably damaging 1.00
R6648:Pgm5 UTSW 19 24861632 missense probably benign 0.02
R6821:Pgm5 UTSW 19 24861647 missense possibly damaging 0.88
R7360:Pgm5 UTSW 19 24834817 missense probably damaging 1.00
R7421:Pgm5 UTSW 19 24709299 missense probably benign 0.03
R7590:Pgm5 UTSW 19 24709265 missense probably damaging 1.00
R7610:Pgm5 UTSW 19 24834756 missense probably damaging 1.00
R7685:Pgm5 UTSW 19 24727851 missense probably benign 0.45
R8254:Pgm5 UTSW 19 24727725 missense probably benign 0.18
R8405:Pgm5 UTSW 19 24727742 missense probably benign 0.01
R8755:Pgm5 UTSW 19 24834848 missense probably damaging 0.98
R9236:Pgm5 UTSW 19 24861639 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGACCACTTGAATTTCATGCTG -3'
(R):5'- GCTGTTTCAGTGGCAGGAAAG -3'

Sequencing Primer
(F):5'- GAATTTCATGCTGCTATATCACACC -3'
(R):5'- AGGCTTGTGTTAATGATGGAAAC -3'
Posted On 2020-10-20