Incidental Mutation 'R8517:F5'
ID656183
Institutional Source Beutler Lab
Gene Symbol F5
Ensembl Gene ENSMUSG00000026579
Gene Namecoagulation factor V
SynonymsCf-5, Cf5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8517 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location164151838-164220277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 164176253 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 206 (F206I)
Ref Sequence ENSEMBL: ENSMUSP00000083204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086040]
Predicted Effect probably damaging
Transcript: ENSMUST00000086040
AA Change: F206I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083204
Gene: ENSMUSG00000026579
AA Change: F206I

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Cu-oxidase_3 67 196 4.4e-10 PFAM
low complexity region 282 300 N/A INTRINSIC
Pfam:Cu-oxidase_3 397 527 1.5e-7 PFAM
low complexity region 1013 1019 N/A INTRINSIC
low complexity region 1045 1058 N/A INTRINSIC
low complexity region 1156 1173 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1368 1382 N/A INTRINSIC
low complexity region 1440 1464 N/A INTRINSIC
Pfam:Cu-oxidase_3 1600 1714 9.1e-8 PFAM
FA58C 1865 2020 8.03e-36 SMART
FA58C 2024 2180 1.96e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays a critical role in the process of blood coagulation and hemostasis. The encoded protein is activated by thrombin, to generate a heterodimer containing heavy and light chains held together by calcium ions. About half of the mice lacking the encoded protein die at an embryonic stage possible due to abnormal yolk-sac vasculature while the remaining animals succumbed to massive hemorrhage immediately after birth. A point mutation in this gene has been shown to cause disseminated intravascular thrombosis in the perinatal period, resulting in frequent deaths of newborn mice. [provided by RefSeq, Apr 2015]
PHENOTYPE: Half of mice homozygous for a null allele die at E9-E10 with defects in yolk-sac vasculature and somite formation; the remaining half develop to term but die of massive hemorrhage within hours of birth. Mice homozygous for a knock-in (F5 Leiden) allele develop strain-specific perinatal thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,969 D131E probably damaging Het
Abca17 C A 17: 24,317,233 V487F probably benign Het
Anapc5 T C 5: 122,821,030 S41G probably benign Het
Aoc1 C T 6: 48,906,710 Q507* probably null Het
Ccdc171 G A 4: 83,743,061 R1136H probably damaging Het
Clspn A G 4: 126,566,219 D413G probably benign Het
Copz2 A G 11: 96,853,483 K74E possibly damaging Het
Cpsf4l C A 11: 113,708,825 A45S probably benign Het
Cr2 T C 1: 195,155,899 I710V probably benign Het
Csmd2 G A 4: 128,552,686 R3348Q Het
Dchs2 A G 3: 83,271,112 I1157M probably damaging Het
Dcst1 A G 3: 89,365,148 F3L probably benign Het
Dennd5b A C 6: 149,029,121 C743G probably damaging Het
Dnah6 T C 6: 73,178,457 E725G probably benign Het
Dnajc3 G T 14: 118,953,177 G51* probably null Het
Dyrk2 T C 10: 118,861,021 T111A probably benign Het
Fam217b T A 2: 178,420,772 S176R probably benign Het
Farsb A T 1: 78,463,296 L313* probably null Het
Fbxo18 A G 2: 11,777,430 probably null Het
Fgd4 G A 16: 16,422,645 T740I probably benign Het
Gm14124 A T 2: 150,268,123 E244D probably benign Het
Gprc6a G T 10: 51,631,241 A64D probably benign Het
Gtf3c1 A T 7: 125,654,551 V1365E probably damaging Het
Hdc C G 2: 126,597,970 probably null Het
Igkv5-39 T G 6: 69,900,569 I68L possibly damaging Het
Kcnh2 A T 5: 24,326,638 V425D probably damaging Het
Kcnj12 T C 11: 61,069,373 S166P probably benign Het
Krtap16-1 A T 11: 99,985,698 C293* probably null Het
Map7 T C 10: 20,261,835 V251A probably damaging Het
Myo7b G T 18: 31,967,191 L1597M possibly damaging Het
Nmu T C 5: 76,345,479 E82G possibly damaging Het
Nup85 T C 11: 115,564,564 probably null Het
Nwd2 A G 5: 63,791,582 N166D probably damaging Het
Olfr667 T A 7: 104,916,474 H274L possibly damaging Het
Pbrm1 C A 14: 31,067,782 D784E probably benign Het
Pcdhgb1 T A 18: 37,682,064 M536K possibly damaging Het
Pml T A 9: 58,220,368 Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 Y294C probably benign Het
Rasal2 T C 1: 157,146,279 probably null Het
Rims1 T A 1: 22,483,165 H484L probably damaging Het
Rpia C A 6: 70,766,646 V274L possibly damaging Het
Sart1 A G 19: 5,383,197 L424P probably damaging Het
Scnm1 A C 3: 95,132,823 probably null Het
Slfn8 T A 11: 83,004,142 M613L possibly damaging Het
Snph A G 2: 151,593,721 V429A probably damaging Het
Tarbp1 T A 8: 126,444,195 D1022V probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ttc8 A G 12: 98,943,335 N100D probably benign Het
Zbtb49 T A 5: 38,200,653 H752L probably benign Het
Zfp263 T C 16: 3,746,896 probably null Het
Zfp46 A G 4: 136,291,147 T431A probably benign Het
Other mutations in F5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:F5 APN 1 164179524 missense probably benign 0.15
IGL00843:F5 APN 1 164211791 missense probably benign 0.00
IGL00904:F5 APN 1 164194009 missense probably benign
IGL00913:F5 APN 1 164204896 missense probably damaging 1.00
IGL01099:F5 APN 1 164194334 missense probably damaging 0.99
IGL01134:F5 APN 1 164191979 missense possibly damaging 0.87
IGL01313:F5 APN 1 164193612 missense probably benign 0.01
IGL01635:F5 APN 1 164207858 missense probably benign 0.00
IGL01697:F5 APN 1 164194052 missense probably benign 0.04
IGL01768:F5 APN 1 164176345 missense probably benign 0.22
IGL01795:F5 APN 1 164194390 missense probably benign 0.00
IGL01835:F5 APN 1 164194368 missense probably benign 0.12
IGL01843:F5 APN 1 164211826 missense probably benign 0.05
IGL01989:F5 APN 1 164176307 missense probably benign 0.39
IGL02036:F5 APN 1 164183002 splice site probably benign
IGL02065:F5 APN 1 164190126 missense probably damaging 1.00
IGL02077:F5 APN 1 164198866 missense probably damaging 1.00
IGL02139:F5 APN 1 164192674 missense possibly damaging 0.89
IGL02210:F5 APN 1 164190141 missense probably benign 0.00
IGL02415:F5 APN 1 164191929 missense probably damaging 1.00
IGL02440:F5 APN 1 164207066 missense possibly damaging 0.79
IGL02471:F5 APN 1 164174291 missense probably damaging 1.00
IGL02535:F5 APN 1 164198733 missense probably damaging 0.98
IGL02537:F5 APN 1 164193117 missense probably benign 0.26
IGL02628:F5 APN 1 164194075 missense probably damaging 0.99
IGL02638:F5 APN 1 164184608 critical splice donor site probably null
IGL02824:F5 APN 1 164194347 missense probably benign 0.00
IGL02977:F5 APN 1 164194021 missense probably damaging 1.00
IGL03028:F5 APN 1 164193000 nonsense probably null
IGL03064:F5 APN 1 164195594 missense probably benign 0.04
IGL03127:F5 APN 1 164193538 missense probably benign 0.45
IGL03131:F5 APN 1 164161819 missense possibly damaging 0.62
IGL03348:F5 APN 1 164194152 missense possibly damaging 0.49
IGL03387:F5 APN 1 164193232 missense probably damaging 1.00
James_dean UTSW 1 164204820 missense probably benign 0.43
BB002:F5 UTSW 1 164176366 critical splice donor site probably null
BB012:F5 UTSW 1 164176366 critical splice donor site probably null
R0002:F5 UTSW 1 164201631 missense probably damaging 1.00
R0095:F5 UTSW 1 164191968 nonsense probably null
R0116:F5 UTSW 1 164184914 missense probably benign 0.01
R0359:F5 UTSW 1 164179449 missense probably damaging 1.00
R0426:F5 UTSW 1 164182840 missense probably damaging 0.99
R0452:F5 UTSW 1 164185107 missense probably damaging 0.99
R0457:F5 UTSW 1 164194200 missense probably benign 0.00
R0520:F5 UTSW 1 164209587 missense probably benign 0.15
R0522:F5 UTSW 1 164211763 missense probably damaging 1.00
R0554:F5 UTSW 1 164179449 missense probably damaging 1.00
R0575:F5 UTSW 1 164176244 missense probably damaging 1.00
R0734:F5 UTSW 1 164198917 missense probably damaging 1.00
R0739:F5 UTSW 1 164198917 missense probably damaging 1.00
R1062:F5 UTSW 1 164198917 missense probably damaging 1.00
R1063:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1150:F5 UTSW 1 164198917 missense probably damaging 1.00
R1151:F5 UTSW 1 164198917 missense probably damaging 1.00
R1152:F5 UTSW 1 164198917 missense probably damaging 1.00
R1221:F5 UTSW 1 164161799 missense probably damaging 1.00
R1284:F5 UTSW 1 164198917 missense probably damaging 1.00
R1286:F5 UTSW 1 164198917 missense probably damaging 1.00
R1358:F5 UTSW 1 164198917 missense probably damaging 1.00
R1360:F5 UTSW 1 164198917 missense probably damaging 1.00
R1362:F5 UTSW 1 164198917 missense probably damaging 1.00
R1383:F5 UTSW 1 164198917 missense probably damaging 1.00
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1545:F5 UTSW 1 164208960 nonsense probably null
R1561:F5 UTSW 1 164186903 nonsense probably null
R1623:F5 UTSW 1 164195622 missense probably damaging 1.00
R1662:F5 UTSW 1 164207888 missense probably damaging 1.00
R1673:F5 UTSW 1 164179520 missense probably damaging 1.00
R1689:F5 UTSW 1 164198917 missense probably damaging 1.00
R1705:F5 UTSW 1 164217490 missense possibly damaging 0.92
R1732:F5 UTSW 1 164174150 missense probably damaging 1.00
R1763:F5 UTSW 1 164192535 missense probably benign 0.04
R1774:F5 UTSW 1 164192535 missense probably benign 0.04
R1799:F5 UTSW 1 164193531 missense possibly damaging 0.58
R1800:F5 UTSW 1 164182834 missense probably damaging 1.00
R1842:F5 UTSW 1 164184560 missense probably damaging 0.99
R1915:F5 UTSW 1 164182917 missense probably damaging 0.97
R1926:F5 UTSW 1 164179508 missense probably damaging 1.00
R2025:F5 UTSW 1 164209475 missense probably benign 0.05
R2198:F5 UTSW 1 164207034 missense probably damaging 1.00
R2258:F5 UTSW 1 164192181 missense probably damaging 1.00
R2264:F5 UTSW 1 164194402 missense probably benign 0.32
R2281:F5 UTSW 1 164195720 missense possibly damaging 0.80
R2407:F5 UTSW 1 164211872 missense probably damaging 1.00
R2445:F5 UTSW 1 164190226 missense probably damaging 1.00
R2860:F5 UTSW 1 164184964 missense probably damaging 1.00
R2861:F5 UTSW 1 164184964 missense probably damaging 1.00
R2862:F5 UTSW 1 164184964 missense probably damaging 1.00
R2899:F5 UTSW 1 164186900 missense possibly damaging 0.88
R2910:F5 UTSW 1 164204820 missense probably benign 0.43
R2912:F5 UTSW 1 164193919 missense probably damaging 0.98
R2996:F5 UTSW 1 164182917 missense probably damaging 0.97
R3745:F5 UTSW 1 164186779 missense possibly damaging 0.79
R3901:F5 UTSW 1 164176229 missense probably benign 0.08
R3902:F5 UTSW 1 164176229 missense probably benign 0.08
R4365:F5 UTSW 1 164184950 missense probably damaging 0.98
R4448:F5 UTSW 1 164198899 missense possibly damaging 0.52
R4490:F5 UTSW 1 164217395 missense probably benign 0.40
R4514:F5 UTSW 1 164151997 unclassified probably benign
R4598:F5 UTSW 1 164204797 missense probably benign 0.05
R4608:F5 UTSW 1 164209029 missense probably benign 0.12
R4661:F5 UTSW 1 164184920 missense probably damaging 1.00
R4667:F5 UTSW 1 164174186 missense probably benign 0.00
R4689:F5 UTSW 1 164151973 unclassified probably benign
R4716:F5 UTSW 1 164193919 missense probably damaging 0.98
R4732:F5 UTSW 1 164181657 missense probably damaging 1.00
R4733:F5 UTSW 1 164181657 missense probably damaging 1.00
R4854:F5 UTSW 1 164192146 missense probably damaging 1.00
R4908:F5 UTSW 1 164211820 missense probably damaging 1.00
R4971:F5 UTSW 1 164194186 missense probably benign
R5001:F5 UTSW 1 164195570 missense probably benign 0.00
R5042:F5 UTSW 1 164219451 missense probably damaging 1.00
R5056:F5 UTSW 1 164192032 missense possibly damaging 0.60
R5061:F5 UTSW 1 164194180 missense probably benign 0.00
R5143:F5 UTSW 1 164211828 missense probably damaging 0.98
R5622:F5 UTSW 1 164192565 missense probably benign 0.09
R5626:F5 UTSW 1 164209035 missense probably damaging 0.98
R5658:F5 UTSW 1 164192338 missense probably damaging 0.96
R5702:F5 UTSW 1 164194547 nonsense probably null
R5795:F5 UTSW 1 164152009 missense probably benign 0.09
R5884:F5 UTSW 1 164195646 missense probably benign 0.01
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6151:F5 UTSW 1 164181635 missense probably damaging 1.00
R6151:F5 UTSW 1 164190187 missense probably damaging 1.00
R6345:F5 UTSW 1 164191951 missense probably benign 0.13
R6391:F5 UTSW 1 164193493 missense probably damaging 0.99
R6542:F5 UTSW 1 164194468 missense probably benign 0.32
R6620:F5 UTSW 1 164186806 missense probably damaging 1.00
R6750:F5 UTSW 1 164193507 missense possibly damaging 0.58
R6754:F5 UTSW 1 164193763 missense probably damaging 1.00
R6774:F5 UTSW 1 164186878 missense probably damaging 1.00
R6802:F5 UTSW 1 164179356 missense probably damaging 0.98
R6810:F5 UTSW 1 164186902 missense probably damaging 1.00
R6983:F5 UTSW 1 164194129 missense probably damaging 1.00
R7000:F5 UTSW 1 164179506 missense probably damaging 1.00
R7151:F5 UTSW 1 164201661 missense probably damaging 1.00
R7193:F5 UTSW 1 164219397 missense probably damaging 1.00
R7230:F5 UTSW 1 164184953 missense probably benign
R7324:F5 UTSW 1 164193581 small deletion probably benign
R7350:F5 UTSW 1 164192708 missense probably benign 0.08
R7466:F5 UTSW 1 164193328 missense possibly damaging 0.61
R7503:F5 UTSW 1 164192210 missense probably damaging 1.00
R7626:F5 UTSW 1 164186912 missense possibly damaging 0.95
R7742:F5 UTSW 1 164207884 missense possibly damaging 0.51
R7837:F5 UTSW 1 164186794 missense probably damaging 1.00
R7848:F5 UTSW 1 164161877 missense possibly damaging 0.94
R7925:F5 UTSW 1 164176366 critical splice donor site probably null
R8053:F5 UTSW 1 164192769 missense probably benign 0.26
R8094:F5 UTSW 1 164208940 missense probably benign 0.06
R8175:F5 UTSW 1 164192265 nonsense probably null
R8209:F5 UTSW 1 164194390 missense probably benign 0.00
R8226:F5 UTSW 1 164194390 missense probably benign 0.00
R8266:F5 UTSW 1 164185124 critical splice donor site probably null
R8684:F5 UTSW 1 164217542 missense probably benign 0.01
X0024:F5 UTSW 1 164192988 missense probably damaging 1.00
Z1088:F5 UTSW 1 164154385 missense probably benign 0.04
Z1176:F5 UTSW 1 164184516 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCGCATGTCCCATTTAATGAGG -3'
(R):5'- TGAACACGGTAGCTTCTGCC -3'

Sequencing Primer
(F):5'- GAATGCATCCTAACACTTGACTGGG -3'
(R):5'- GAACACGGTAGCTTCTGCCTTAAAG -3'
Posted On2020-10-20