Incidental Mutation 'R8517:Fam217b'
ID656189
Institutional Source Beutler Lab
Gene Symbol Fam217b
Ensembl Gene ENSMUSG00000070476
Gene Namefamily with sequence similarity 217, member B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8517 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location178414524-178424428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 178420772 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 176 (S176R)
Ref Sequence ENSEMBL: ENSMUSP00000091805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094251]
Predicted Effect probably benign
Transcript: ENSMUST00000094251
AA Change: S176R

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091805
Gene: ENSMUSG00000070476
AA Change: S176R

DomainStartEndE-ValueType
Pfam:FAM217 103 331 2.2e-91 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,969 D131E probably damaging Het
Abca17 C A 17: 24,317,233 V487F probably benign Het
Anapc5 T C 5: 122,821,030 S41G probably benign Het
Aoc1 C T 6: 48,906,710 Q507* probably null Het
Ccdc171 G A 4: 83,743,061 R1136H probably damaging Het
Clspn A G 4: 126,566,219 D413G probably benign Het
Copz2 A G 11: 96,853,483 K74E possibly damaging Het
Cpsf4l C A 11: 113,708,825 A45S probably benign Het
Cr2 T C 1: 195,155,899 I710V probably benign Het
Csmd2 G A 4: 128,552,686 R3348Q Het
Dchs2 A G 3: 83,271,112 I1157M probably damaging Het
Dcst1 A G 3: 89,365,148 F3L probably benign Het
Dennd5b A C 6: 149,029,121 C743G probably damaging Het
Dnah6 T C 6: 73,178,457 E725G probably benign Het
Dnajc3 G T 14: 118,953,177 G51* probably null Het
Dyrk2 T C 10: 118,861,021 T111A probably benign Het
F5 T A 1: 164,176,253 F206I probably damaging Het
Farsb A T 1: 78,463,296 L313* probably null Het
Fbxo18 A G 2: 11,777,430 probably null Het
Fgd4 G A 16: 16,422,645 T740I probably benign Het
Gm14124 A T 2: 150,268,123 E244D probably benign Het
Gprc6a G T 10: 51,631,241 A64D probably benign Het
Gtf3c1 A T 7: 125,654,551 V1365E probably damaging Het
Hdc C G 2: 126,597,970 probably null Het
Igkv5-39 T G 6: 69,900,569 I68L possibly damaging Het
Kcnh2 A T 5: 24,326,638 V425D probably damaging Het
Kcnj12 T C 11: 61,069,373 S166P probably benign Het
Krtap16-1 A T 11: 99,985,698 C293* probably null Het
Map7 T C 10: 20,261,835 V251A probably damaging Het
Myo7b G T 18: 31,967,191 L1597M possibly damaging Het
Nmu T C 5: 76,345,479 E82G possibly damaging Het
Nup85 T C 11: 115,564,564 probably null Het
Nwd2 A G 5: 63,791,582 N166D probably damaging Het
Olfr667 T A 7: 104,916,474 H274L possibly damaging Het
Pbrm1 C A 14: 31,067,782 D784E probably benign Het
Pcdhgb1 T A 18: 37,682,064 M536K possibly damaging Het
Pml T A 9: 58,220,368 Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 Y294C probably benign Het
Rasal2 T C 1: 157,146,279 probably null Het
Rims1 T A 1: 22,483,165 H484L probably damaging Het
Rpia C A 6: 70,766,646 V274L possibly damaging Het
Sart1 A G 19: 5,383,197 L424P probably damaging Het
Scnm1 A C 3: 95,132,823 probably null Het
Slfn8 T A 11: 83,004,142 M613L possibly damaging Het
Snph A G 2: 151,593,721 V429A probably damaging Het
Tarbp1 T A 8: 126,444,195 D1022V probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ttc8 A G 12: 98,943,335 N100D probably benign Het
Zbtb49 T A 5: 38,200,653 H752L probably benign Het
Zfp263 T C 16: 3,746,896 probably null Het
Zfp46 A G 4: 136,291,147 T431A probably benign Het
Other mutations in Fam217b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fam217b APN 2 178421150 missense probably damaging 0.96
IGL01866:Fam217b APN 2 178420431 missense probably benign
IGL01974:Fam217b APN 2 178421227 missense probably damaging 1.00
IGL02376:Fam217b APN 2 178417573 missense probably benign
R0787:Fam217b UTSW 2 178420909 missense probably benign 0.01
R0833:Fam217b UTSW 2 178420989 missense probably benign 0.00
R0836:Fam217b UTSW 2 178420989 missense probably benign 0.00
R1381:Fam217b UTSW 2 178420425 missense probably benign
R1903:Fam217b UTSW 2 178420581 missense probably benign 0.32
R5953:Fam217b UTSW 2 178420360 missense probably damaging 1.00
R6699:Fam217b UTSW 2 178420417 missense probably benign
R7226:Fam217b UTSW 2 178421203 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCCAGAGCTCAACCTCAGAG -3'
(R):5'- TTCGAGAAGGGCCTGACTTTG -3'

Sequencing Primer
(F):5'- GCCGAAGAGATAGACCCGGTTTC -3'
(R):5'- AGGGCCTGACTTTGAAATCC -3'
Posted On2020-10-20