Incidental Mutation 'R8517:Fam217b'
ID 656189
Institutional Source Beutler Lab
Gene Symbol Fam217b
Ensembl Gene ENSMUSG00000070476
Gene Name family with sequence similarity 217, member B
Synonyms 9030418K01Rik
MMRRC Submission 067849-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8517 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 178056317-178066221 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 178062565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 176 (S176R)
Ref Sequence ENSEMBL: ENSMUSP00000091805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094251]
AlphaFold A2AJW5
Predicted Effect probably benign
Transcript: ENSMUST00000094251
AA Change: S176R

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091805
Gene: ENSMUSG00000070476
AA Change: S176R

DomainStartEndE-ValueType
Pfam:FAM217 103 331 2.2e-91 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,206 (GRCm39) D131E probably damaging Het
Abca17 C A 17: 24,536,207 (GRCm39) V487F probably benign Het
Anapc5 T C 5: 122,959,093 (GRCm39) S41G probably benign Het
Aoc1 C T 6: 48,883,644 (GRCm39) Q507* probably null Het
Ccdc171 G A 4: 83,661,298 (GRCm39) R1136H probably damaging Het
Clspn A G 4: 126,460,012 (GRCm39) D413G probably benign Het
Copz2 A G 11: 96,744,309 (GRCm39) K74E possibly damaging Het
Cpsf4l C A 11: 113,599,651 (GRCm39) A45S probably benign Het
Cr2 T C 1: 194,838,207 (GRCm39) I710V probably benign Het
Csmd2 G A 4: 128,446,479 (GRCm39) R3348Q Het
Dchs2 A G 3: 83,178,419 (GRCm39) I1157M probably damaging Het
Dcst1 A G 3: 89,272,455 (GRCm39) F3L probably benign Het
Dennd5b A C 6: 148,930,619 (GRCm39) C743G probably damaging Het
Dnah6 T C 6: 73,155,440 (GRCm39) E725G probably benign Het
Dnajc3 G T 14: 119,190,589 (GRCm39) G51* probably null Het
Dyrk2 T C 10: 118,696,926 (GRCm39) T111A probably benign Het
F5 T A 1: 164,003,822 (GRCm39) F206I probably damaging Het
Farsb A T 1: 78,439,933 (GRCm39) L313* probably null Het
Fbh1 A G 2: 11,782,241 (GRCm39) probably null Het
Fgd4 G A 16: 16,240,509 (GRCm39) T740I probably benign Het
Gprc6a G T 10: 51,507,337 (GRCm39) A64D probably benign Het
Gtf3c1 A T 7: 125,253,723 (GRCm39) V1365E probably damaging Het
Hdc C G 2: 126,439,890 (GRCm39) probably null Het
Igkv5-39 T G 6: 69,877,553 (GRCm39) I68L possibly damaging Het
Kcnh2 A T 5: 24,531,636 (GRCm39) V425D probably damaging Het
Kcnj12 T C 11: 60,960,199 (GRCm39) S166P probably benign Het
Krtap16-1 A T 11: 99,876,524 (GRCm39) C293* probably null Het
Map7 T C 10: 20,137,581 (GRCm39) V251A probably damaging Het
Myo7b G T 18: 32,100,244 (GRCm39) L1597M possibly damaging Het
Nmu T C 5: 76,493,326 (GRCm39) E82G possibly damaging Het
Nup85 T C 11: 115,455,390 (GRCm39) probably null Het
Nwd2 A G 5: 63,948,925 (GRCm39) N166D probably damaging Het
Or52n2b T A 7: 104,565,681 (GRCm39) H274L possibly damaging Het
Pbrm1 C A 14: 30,789,739 (GRCm39) D784E probably benign Het
Pcdhgb1 T A 18: 37,815,117 (GRCm39) M536K possibly damaging Het
Pml T A 9: 58,127,651 (GRCm39) Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 (GRCm39) Y294C probably benign Het
Rasal2 T C 1: 156,973,849 (GRCm39) probably null Het
Rims1 T A 1: 22,522,246 (GRCm39) H484L probably damaging Het
Rpia C A 6: 70,743,630 (GRCm39) V274L possibly damaging Het
Sart1 A G 19: 5,433,225 (GRCm39) L424P probably damaging Het
Scnm1 A C 3: 95,040,134 (GRCm39) probably null Het
Slfn8 T A 11: 82,894,968 (GRCm39) M613L possibly damaging Het
Snph A G 2: 151,435,641 (GRCm39) V429A probably damaging Het
Tarbp1 T A 8: 127,170,934 (GRCm39) D1022V probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Ttc8 A G 12: 98,909,594 (GRCm39) N100D probably benign Het
Zbtb49 T A 5: 38,357,997 (GRCm39) H752L probably benign Het
Zfp1005 A T 2: 150,110,043 (GRCm39) E244D probably benign Het
Zfp263 T C 16: 3,564,760 (GRCm39) probably null Het
Zfp46 A G 4: 136,018,458 (GRCm39) T431A probably benign Het
Other mutations in Fam217b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fam217b APN 2 178,062,943 (GRCm39) missense probably damaging 0.96
IGL01866:Fam217b APN 2 178,062,224 (GRCm39) missense probably benign
IGL01974:Fam217b APN 2 178,063,020 (GRCm39) missense probably damaging 1.00
IGL02376:Fam217b APN 2 178,059,366 (GRCm39) missense probably benign
R0787:Fam217b UTSW 2 178,062,702 (GRCm39) missense probably benign 0.01
R0833:Fam217b UTSW 2 178,062,782 (GRCm39) missense probably benign 0.00
R0836:Fam217b UTSW 2 178,062,782 (GRCm39) missense probably benign 0.00
R1381:Fam217b UTSW 2 178,062,218 (GRCm39) missense probably benign
R1903:Fam217b UTSW 2 178,062,374 (GRCm39) missense probably benign 0.32
R5953:Fam217b UTSW 2 178,062,153 (GRCm39) missense probably damaging 1.00
R6699:Fam217b UTSW 2 178,062,210 (GRCm39) missense probably benign
R7226:Fam217b UTSW 2 178,062,996 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCCAGAGCTCAACCTCAGAG -3'
(R):5'- TTCGAGAAGGGCCTGACTTTG -3'

Sequencing Primer
(F):5'- GCCGAAGAGATAGACCCGGTTTC -3'
(R):5'- AGGGCCTGACTTTGAAATCC -3'
Posted On 2020-10-20