Incidental Mutation 'R8517:Ccdc171'
ID 656194
Institutional Source Beutler Lab
Gene Symbol Ccdc171
Ensembl Gene ENSMUSG00000052407
Gene Name coiled-coil domain containing 171
Synonyms A330015D16Rik, 4930418J05Rik, 4930473A06Rik
MMRRC Submission 067849-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8517 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 83443782-83782907 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 83661298 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1136 (R1136H)
Ref Sequence ENSEMBL: ENSMUSP00000056520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053414] [ENSMUST00000125077] [ENSMUST00000231339]
AlphaFold E9Q1U1
Predicted Effect probably damaging
Transcript: ENSMUST00000053414
AA Change: R1136H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056520
Gene: ENSMUSG00000052407
AA Change: R1136H

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 527 N/A INTRINSIC
coiled coil region 599 628 N/A INTRINSIC
coiled coil region 653 712 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 783 797 N/A INTRINSIC
coiled coil region 981 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125077
SMART Domains Protein: ENSMUSP00000116486
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 535 N/A INTRINSIC
coiled coil region 607 636 N/A INTRINSIC
coiled coil region 661 720 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
coiled coil region 989 1153 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000231339
AA Change: R1144H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that either homozygous or heterozygous for an ENU-induced single point mutation exhibit decreased mature B cell number, decreased IgD level, and increased IgM level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,206 (GRCm39) D131E probably damaging Het
Abca17 C A 17: 24,536,207 (GRCm39) V487F probably benign Het
Anapc5 T C 5: 122,959,093 (GRCm39) S41G probably benign Het
Aoc1 C T 6: 48,883,644 (GRCm39) Q507* probably null Het
Clspn A G 4: 126,460,012 (GRCm39) D413G probably benign Het
Copz2 A G 11: 96,744,309 (GRCm39) K74E possibly damaging Het
Cpsf4l C A 11: 113,599,651 (GRCm39) A45S probably benign Het
Cr2 T C 1: 194,838,207 (GRCm39) I710V probably benign Het
Csmd2 G A 4: 128,446,479 (GRCm39) R3348Q Het
Dchs2 A G 3: 83,178,419 (GRCm39) I1157M probably damaging Het
Dcst1 A G 3: 89,272,455 (GRCm39) F3L probably benign Het
Dennd5b A C 6: 148,930,619 (GRCm39) C743G probably damaging Het
Dnah6 T C 6: 73,155,440 (GRCm39) E725G probably benign Het
Dnajc3 G T 14: 119,190,589 (GRCm39) G51* probably null Het
Dyrk2 T C 10: 118,696,926 (GRCm39) T111A probably benign Het
F5 T A 1: 164,003,822 (GRCm39) F206I probably damaging Het
Fam217b T A 2: 178,062,565 (GRCm39) S176R probably benign Het
Farsb A T 1: 78,439,933 (GRCm39) L313* probably null Het
Fbh1 A G 2: 11,782,241 (GRCm39) probably null Het
Fgd4 G A 16: 16,240,509 (GRCm39) T740I probably benign Het
Gprc6a G T 10: 51,507,337 (GRCm39) A64D probably benign Het
Gtf3c1 A T 7: 125,253,723 (GRCm39) V1365E probably damaging Het
Hdc C G 2: 126,439,890 (GRCm39) probably null Het
Igkv5-39 T G 6: 69,877,553 (GRCm39) I68L possibly damaging Het
Kcnh2 A T 5: 24,531,636 (GRCm39) V425D probably damaging Het
Kcnj12 T C 11: 60,960,199 (GRCm39) S166P probably benign Het
Krtap16-1 A T 11: 99,876,524 (GRCm39) C293* probably null Het
Map7 T C 10: 20,137,581 (GRCm39) V251A probably damaging Het
Myo7b G T 18: 32,100,244 (GRCm39) L1597M possibly damaging Het
Nmu T C 5: 76,493,326 (GRCm39) E82G possibly damaging Het
Nup85 T C 11: 115,455,390 (GRCm39) probably null Het
Nwd2 A G 5: 63,948,925 (GRCm39) N166D probably damaging Het
Or52n2b T A 7: 104,565,681 (GRCm39) H274L possibly damaging Het
Pbrm1 C A 14: 30,789,739 (GRCm39) D784E probably benign Het
Pcdhgb1 T A 18: 37,815,117 (GRCm39) M536K possibly damaging Het
Pml T A 9: 58,127,651 (GRCm39) Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 (GRCm39) Y294C probably benign Het
Rasal2 T C 1: 156,973,849 (GRCm39) probably null Het
Rims1 T A 1: 22,522,246 (GRCm39) H484L probably damaging Het
Rpia C A 6: 70,743,630 (GRCm39) V274L possibly damaging Het
Sart1 A G 19: 5,433,225 (GRCm39) L424P probably damaging Het
Scnm1 A C 3: 95,040,134 (GRCm39) probably null Het
Slfn8 T A 11: 82,894,968 (GRCm39) M613L possibly damaging Het
Snph A G 2: 151,435,641 (GRCm39) V429A probably damaging Het
Tarbp1 T A 8: 127,170,934 (GRCm39) D1022V probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Ttc8 A G 12: 98,909,594 (GRCm39) N100D probably benign Het
Zbtb49 T A 5: 38,357,997 (GRCm39) H752L probably benign Het
Zfp1005 A T 2: 150,110,043 (GRCm39) E244D probably benign Het
Zfp263 T C 16: 3,564,760 (GRCm39) probably null Het
Zfp46 A G 4: 136,018,458 (GRCm39) T431A probably benign Het
Other mutations in Ccdc171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Ccdc171 APN 4 83,600,561 (GRCm39) nonsense probably null
IGL00707:Ccdc171 APN 4 83,599,392 (GRCm39) missense probably benign 0.11
IGL00907:Ccdc171 APN 4 83,782,486 (GRCm39) missense probably damaging 0.98
IGL01113:Ccdc171 APN 4 83,580,047 (GRCm39) missense probably damaging 1.00
IGL01669:Ccdc171 APN 4 83,599,432 (GRCm39) missense probably damaging 1.00
IGL01696:Ccdc171 APN 4 83,573,815 (GRCm39) missense possibly damaging 0.66
IGL02006:Ccdc171 APN 4 83,713,479 (GRCm39) missense possibly damaging 0.93
IGL02582:Ccdc171 APN 4 83,661,255 (GRCm39) missense probably damaging 1.00
IGL03019:Ccdc171 APN 4 83,713,545 (GRCm39) missense probably damaging 1.00
IGL03144:Ccdc171 APN 4 83,736,327 (GRCm39) missense probably damaging 0.99
IGL03350:Ccdc171 APN 4 83,599,615 (GRCm39) missense possibly damaging 0.67
IGL03377:Ccdc171 APN 4 83,581,754 (GRCm39) missense probably damaging 1.00
PIT4131001:Ccdc171 UTSW 4 83,579,946 (GRCm39)
PIT4445001:Ccdc171 UTSW 4 83,579,984 (GRCm39) missense probably damaging 1.00
R0219:Ccdc171 UTSW 4 83,614,678 (GRCm39) splice site probably benign
R0284:Ccdc171 UTSW 4 83,467,975 (GRCm39) missense possibly damaging 0.62
R0355:Ccdc171 UTSW 4 83,553,919 (GRCm39) missense probably damaging 1.00
R1248:Ccdc171 UTSW 4 83,599,481 (GRCm39) missense possibly damaging 0.46
R1278:Ccdc171 UTSW 4 83,580,095 (GRCm39) missense possibly damaging 0.90
R1495:Ccdc171 UTSW 4 83,599,332 (GRCm39) nonsense probably null
R1741:Ccdc171 UTSW 4 83,539,076 (GRCm39) missense probably damaging 0.97
R1742:Ccdc171 UTSW 4 83,599,521 (GRCm39) missense probably damaging 0.99
R1789:Ccdc171 UTSW 4 83,473,045 (GRCm39) missense probably damaging 0.99
R1801:Ccdc171 UTSW 4 83,465,132 (GRCm39) missense probably benign 0.41
R4204:Ccdc171 UTSW 4 83,599,392 (GRCm39) missense probably benign 0.11
R4245:Ccdc171 UTSW 4 83,473,045 (GRCm39) missense probably damaging 0.99
R4502:Ccdc171 UTSW 4 83,782,560 (GRCm39) missense probably damaging 1.00
R4503:Ccdc171 UTSW 4 83,782,560 (GRCm39) missense probably damaging 1.00
R4533:Ccdc171 UTSW 4 83,575,579 (GRCm39) missense possibly damaging 0.66
R4589:Ccdc171 UTSW 4 83,467,855 (GRCm39) missense probably benign 0.11
R4782:Ccdc171 UTSW 4 83,599,253 (GRCm39) missense probably damaging 0.99
R4815:Ccdc171 UTSW 4 83,713,458 (GRCm39) missense probably damaging 1.00
R4868:Ccdc171 UTSW 4 83,612,569 (GRCm39) missense probably damaging 1.00
R4926:Ccdc171 UTSW 4 83,476,829 (GRCm39) intron probably benign
R4937:Ccdc171 UTSW 4 83,467,876 (GRCm39) missense probably damaging 1.00
R5120:Ccdc171 UTSW 4 83,476,763 (GRCm39) intron probably benign
R5185:Ccdc171 UTSW 4 83,581,892 (GRCm39) missense possibly damaging 0.84
R5210:Ccdc171 UTSW 4 83,473,093 (GRCm39) missense probably damaging 1.00
R5243:Ccdc171 UTSW 4 83,522,344 (GRCm39) missense probably damaging 1.00
R5484:Ccdc171 UTSW 4 83,612,199 (GRCm39) missense probably benign 0.00
R5574:Ccdc171 UTSW 4 83,611,990 (GRCm39) missense probably damaging 1.00
R6053:Ccdc171 UTSW 4 83,713,456 (GRCm39) missense probably damaging 1.00
R6135:Ccdc171 UTSW 4 83,473,087 (GRCm39) missense probably benign 0.12
R6140:Ccdc171 UTSW 4 83,614,554 (GRCm39) nonsense probably null
R6339:Ccdc171 UTSW 4 83,661,234 (GRCm39) missense probably damaging 1.00
R6452:Ccdc171 UTSW 4 83,782,527 (GRCm39) missense probably damaging 1.00
R7111:Ccdc171 UTSW 4 83,611,998 (GRCm39) missense probably benign 0.00
R7352:Ccdc171 UTSW 4 83,736,260 (GRCm39) missense possibly damaging 0.82
R7390:Ccdc171 UTSW 4 83,736,304 (GRCm39) missense probably damaging 1.00
R7626:Ccdc171 UTSW 4 83,499,012 (GRCm39) nonsense probably null
R7686:Ccdc171 UTSW 4 83,575,556 (GRCm39) missense unknown
R7705:Ccdc171 UTSW 4 83,476,193 (GRCm39) missense possibly damaging 0.87
R7934:Ccdc171 UTSW 4 83,614,492 (GRCm39) nonsense probably null
R8058:Ccdc171 UTSW 4 83,499,003 (GRCm39) missense probably damaging 0.99
R8114:Ccdc171 UTSW 4 83,614,537 (GRCm39) missense probably damaging 1.00
R8253:Ccdc171 UTSW 4 83,661,207 (GRCm39) missense probably damaging 0.99
R8257:Ccdc171 UTSW 4 83,614,606 (GRCm39) missense probably damaging 1.00
R8378:Ccdc171 UTSW 4 83,782,490 (GRCm39) missense possibly damaging 0.67
R8501:Ccdc171 UTSW 4 83,581,895 (GRCm39) nonsense probably null
R8697:Ccdc171 UTSW 4 83,600,577 (GRCm39) missense probably damaging 1.00
R9149:Ccdc171 UTSW 4 83,612,512 (GRCm39) missense probably damaging 1.00
R9430:Ccdc171 UTSW 4 83,522,362 (GRCm39) missense probably damaging 1.00
R9642:Ccdc171 UTSW 4 83,599,525 (GRCm39) missense probably benign 0.12
R9686:Ccdc171 UTSW 4 83,467,919 (GRCm39) missense probably damaging 1.00
U24488:Ccdc171 UTSW 4 83,579,954 (GRCm39) missense probably damaging 1.00
Z1176:Ccdc171 UTSW 4 83,713,467 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGCTGACAAGTAGCTCTG -3'
(R):5'- GCATAATTTGAGGCTACACAGAAG -3'

Sequencing Primer
(F):5'- GCTGACAAGTAGCTCTGTTTTC -3'
(R):5'- CACTTAGAGTGTGGAGTTAAGAGTC -3'
Posted On 2020-10-20