Incidental Mutation 'R8517:Clspn'
ID 656195
Institutional Source Beutler Lab
Gene Symbol Clspn
Ensembl Gene ENSMUSG00000042489
Gene Name claspin
Synonyms C85083, E130314M08Rik
MMRRC Submission 067849-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8517 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 126450728-126487696 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126460012 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 413 (D413G)
Ref Sequence ENSEMBL: ENSMUSP00000045344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048391] [ENSMUST00000129795]
AlphaFold Q80YR7
Predicted Effect probably benign
Transcript: ENSMUST00000048391
AA Change: D413G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: D413G

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
coiled coil region 159 187 N/A INTRINSIC
low complexity region 214 230 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 477 490 N/A INTRINSIC
coiled coil region 599 626 N/A INTRINSIC
low complexity region 632 658 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 732 753 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 968 975 N/A INTRINSIC
coiled coil region 1001 1036 N/A INTRINSIC
low complexity region 1045 1064 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126512
SMART Domains Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
low complexity region 108 147 N/A INTRINSIC
low complexity region 153 170 N/A INTRINSIC
low complexity region 221 242 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129795
AA Change: D244G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120683
Gene: ENSMUSG00000042489
AA Change: D244G

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,206 (GRCm39) D131E probably damaging Het
Abca17 C A 17: 24,536,207 (GRCm39) V487F probably benign Het
Anapc5 T C 5: 122,959,093 (GRCm39) S41G probably benign Het
Aoc1 C T 6: 48,883,644 (GRCm39) Q507* probably null Het
Ccdc171 G A 4: 83,661,298 (GRCm39) R1136H probably damaging Het
Copz2 A G 11: 96,744,309 (GRCm39) K74E possibly damaging Het
Cpsf4l C A 11: 113,599,651 (GRCm39) A45S probably benign Het
Cr2 T C 1: 194,838,207 (GRCm39) I710V probably benign Het
Csmd2 G A 4: 128,446,479 (GRCm39) R3348Q Het
Dchs2 A G 3: 83,178,419 (GRCm39) I1157M probably damaging Het
Dcst1 A G 3: 89,272,455 (GRCm39) F3L probably benign Het
Dennd5b A C 6: 148,930,619 (GRCm39) C743G probably damaging Het
Dnah6 T C 6: 73,155,440 (GRCm39) E725G probably benign Het
Dnajc3 G T 14: 119,190,589 (GRCm39) G51* probably null Het
Dyrk2 T C 10: 118,696,926 (GRCm39) T111A probably benign Het
F5 T A 1: 164,003,822 (GRCm39) F206I probably damaging Het
Fam217b T A 2: 178,062,565 (GRCm39) S176R probably benign Het
Farsb A T 1: 78,439,933 (GRCm39) L313* probably null Het
Fbh1 A G 2: 11,782,241 (GRCm39) probably null Het
Fgd4 G A 16: 16,240,509 (GRCm39) T740I probably benign Het
Gprc6a G T 10: 51,507,337 (GRCm39) A64D probably benign Het
Gtf3c1 A T 7: 125,253,723 (GRCm39) V1365E probably damaging Het
Hdc C G 2: 126,439,890 (GRCm39) probably null Het
Igkv5-39 T G 6: 69,877,553 (GRCm39) I68L possibly damaging Het
Kcnh2 A T 5: 24,531,636 (GRCm39) V425D probably damaging Het
Kcnj12 T C 11: 60,960,199 (GRCm39) S166P probably benign Het
Krtap16-1 A T 11: 99,876,524 (GRCm39) C293* probably null Het
Map7 T C 10: 20,137,581 (GRCm39) V251A probably damaging Het
Myo7b G T 18: 32,100,244 (GRCm39) L1597M possibly damaging Het
Nmu T C 5: 76,493,326 (GRCm39) E82G possibly damaging Het
Nup85 T C 11: 115,455,390 (GRCm39) probably null Het
Nwd2 A G 5: 63,948,925 (GRCm39) N166D probably damaging Het
Or52n2b T A 7: 104,565,681 (GRCm39) H274L possibly damaging Het
Pbrm1 C A 14: 30,789,739 (GRCm39) D784E probably benign Het
Pcdhgb1 T A 18: 37,815,117 (GRCm39) M536K possibly damaging Het
Pml T A 9: 58,127,651 (GRCm39) Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 (GRCm39) Y294C probably benign Het
Rasal2 T C 1: 156,973,849 (GRCm39) probably null Het
Rims1 T A 1: 22,522,246 (GRCm39) H484L probably damaging Het
Rpia C A 6: 70,743,630 (GRCm39) V274L possibly damaging Het
Sart1 A G 19: 5,433,225 (GRCm39) L424P probably damaging Het
Scnm1 A C 3: 95,040,134 (GRCm39) probably null Het
Slfn8 T A 11: 82,894,968 (GRCm39) M613L possibly damaging Het
Snph A G 2: 151,435,641 (GRCm39) V429A probably damaging Het
Tarbp1 T A 8: 127,170,934 (GRCm39) D1022V probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Ttc8 A G 12: 98,909,594 (GRCm39) N100D probably benign Het
Zbtb49 T A 5: 38,357,997 (GRCm39) H752L probably benign Het
Zfp1005 A T 2: 150,110,043 (GRCm39) E244D probably benign Het
Zfp263 T C 16: 3,564,760 (GRCm39) probably null Het
Zfp46 A G 4: 136,018,458 (GRCm39) T431A probably benign Het
Other mutations in Clspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Clspn APN 4 126,466,971 (GRCm39) missense probably damaging 1.00
IGL02160:Clspn APN 4 126,475,303 (GRCm39) missense probably benign 0.21
IGL02231:Clspn APN 4 126,453,021 (GRCm39) missense probably damaging 0.98
IGL02281:Clspn APN 4 126,459,563 (GRCm39) missense possibly damaging 0.90
IGL02368:Clspn APN 4 126,459,900 (GRCm39) missense probably benign
IGL03149:Clspn APN 4 126,470,295 (GRCm39) splice site probably benign
Durch UTSW 4 126,474,755 (GRCm39) missense probably damaging 0.99
R0012:Clspn UTSW 4 126,458,722 (GRCm39) unclassified probably benign
R0035:Clspn UTSW 4 126,458,796 (GRCm39) splice site probably null
R0035:Clspn UTSW 4 126,458,796 (GRCm39) splice site probably null
R0207:Clspn UTSW 4 126,484,391 (GRCm39) missense possibly damaging 0.82
R0270:Clspn UTSW 4 126,467,029 (GRCm39) missense probably damaging 1.00
R0825:Clspn UTSW 4 126,466,923 (GRCm39) splice site probably benign
R1082:Clspn UTSW 4 126,471,572 (GRCm39) missense possibly damaging 0.95
R1349:Clspn UTSW 4 126,457,770 (GRCm39) missense probably benign
R1568:Clspn UTSW 4 126,475,310 (GRCm39) missense probably benign 0.01
R1649:Clspn UTSW 4 126,460,228 (GRCm39) unclassified probably benign
R1663:Clspn UTSW 4 126,459,768 (GRCm39) missense probably benign 0.00
R2497:Clspn UTSW 4 126,466,140 (GRCm39) missense possibly damaging 0.79
R3107:Clspn UTSW 4 126,485,452 (GRCm39) missense probably benign 0.06
R3951:Clspn UTSW 4 126,470,172 (GRCm39) missense probably damaging 1.00
R3953:Clspn UTSW 4 126,460,230 (GRCm39) frame shift probably null
R3954:Clspn UTSW 4 126,460,230 (GRCm39) frame shift probably null
R3956:Clspn UTSW 4 126,460,230 (GRCm39) frame shift probably null
R4599:Clspn UTSW 4 126,475,253 (GRCm39) missense probably benign 0.14
R4717:Clspn UTSW 4 126,453,849 (GRCm39) missense probably damaging 1.00
R4853:Clspn UTSW 4 126,460,348 (GRCm39) missense probably damaging 0.99
R4854:Clspn UTSW 4 126,469,743 (GRCm39) missense probably benign
R4979:Clspn UTSW 4 126,472,179 (GRCm39) missense probably damaging 1.00
R5363:Clspn UTSW 4 126,455,579 (GRCm39) missense possibly damaging 0.58
R5531:Clspn UTSW 4 126,471,566 (GRCm39) missense probably benign
R5614:Clspn UTSW 4 126,474,755 (GRCm39) missense probably damaging 0.99
R5706:Clspn UTSW 4 126,472,211 (GRCm39) missense probably damaging 1.00
R5806:Clspn UTSW 4 126,479,899 (GRCm39) missense probably damaging 1.00
R6106:Clspn UTSW 4 126,484,434 (GRCm39) missense probably benign 0.00
R6178:Clspn UTSW 4 126,471,529 (GRCm39) splice site probably null
R6223:Clspn UTSW 4 126,479,961 (GRCm39) missense probably damaging 0.99
R6326:Clspn UTSW 4 126,459,532 (GRCm39) missense probably damaging 1.00
R6398:Clspn UTSW 4 126,457,740 (GRCm39) missense probably damaging 1.00
R6714:Clspn UTSW 4 126,459,561 (GRCm39) missense probably damaging 1.00
R7003:Clspn UTSW 4 126,486,513 (GRCm39) missense possibly damaging 0.63
R7034:Clspn UTSW 4 126,474,775 (GRCm39) missense possibly damaging 0.87
R7358:Clspn UTSW 4 126,459,993 (GRCm39) missense probably benign 0.02
R7376:Clspn UTSW 4 126,484,430 (GRCm39) missense possibly damaging 0.65
R7675:Clspn UTSW 4 126,460,113 (GRCm39) missense probably benign 0.00
R8320:Clspn UTSW 4 126,457,743 (GRCm39) missense possibly damaging 0.73
R8547:Clspn UTSW 4 126,455,609 (GRCm39) missense probably damaging 1.00
R9106:Clspn UTSW 4 126,471,243 (GRCm39) intron probably benign
R9223:Clspn UTSW 4 126,484,411 (GRCm39) missense possibly damaging 0.60
R9361:Clspn UTSW 4 126,479,654 (GRCm39) missense probably damaging 0.99
R9527:Clspn UTSW 4 126,453,792 (GRCm39) nonsense probably null
R9717:Clspn UTSW 4 126,458,756 (GRCm39) missense possibly damaging 0.90
T0975:Clspn UTSW 4 126,460,230 (GRCm39) unclassified probably benign
X0014:Clspn UTSW 4 126,469,736 (GRCm39) missense probably damaging 1.00
Z1177:Clspn UTSW 4 126,459,970 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAAACCGTAAACCCTGCAG -3'
(R):5'- TCCACGGTGAATCGTCTCAC -3'

Sequencing Primer
(F):5'- AATGGGTGCTGAGGACTCC -3'
(R):5'- GCCGTCACTACTGCCACTG -3'
Posted On 2020-10-20