Mutagenetix > Incidental Mutation

Incidental Mutation 'R8517:Clspn'

656195

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8517 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126566219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 413 (D413G)

Ref Sequence

ENSEMBL: ENSMUSP00000045344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391] [ENSMUST00000129795]

AlphaFold

Q80YR7

Predicted Effect

probably benign
Transcript: ENSMUST00000048391
AA Change: D413G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: D413G

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126512

SMART Domains

Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
coiled coil region	74	101	N/A	INTRINSIC
low complexity region	108	147	N/A	INTRINSIC
low complexity region	153	170	N/A	INTRINSIC
low complexity region	221	242	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129795
AA Change: D244G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000120683
Gene: ENSMUSG00000042489
AA Change: D244G

Domain	Start	End	E-Value	Type
low complexity region	50	66	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,942,969	D131E	probably damaging	Het
Abca17	C	A	17: 24,317,233	V487F	probably benign	Het
Anapc5	T	C	5: 122,821,030	S41G	probably benign	Het
Aoc1	C	T	6: 48,906,710	Q507*	probably null	Het
Ccdc171	G	A	4: 83,743,061	R1136H	probably damaging	Het
Copz2	A	G	11: 96,853,483	K74E	possibly damaging	Het
Cpsf4l	C	A	11: 113,708,825	A45S	probably benign	Het
Cr2	T	C	1: 195,155,899	I710V	probably benign	Het
Csmd2	G	A	4: 128,552,686	R3348Q		Het
Dchs2	A	G	3: 83,271,112	I1157M	probably damaging	Het
Dcst1	A	G	3: 89,365,148	F3L	probably benign	Het
Dennd5b	A	C	6: 149,029,121	C743G	probably damaging	Het
Dnah6	T	C	6: 73,178,457	E725G	probably benign	Het
Dnajc3	G	T	14: 118,953,177	G51*	probably null	Het
Dyrk2	T	C	10: 118,861,021	T111A	probably benign	Het
F5	T	A	1: 164,176,253	F206I	probably damaging	Het
Fam217b	T	A	2: 178,420,772	S176R	probably benign	Het
Farsb	A	T	1: 78,463,296	L313*	probably null	Het
Fbxo18	A	G	2: 11,777,430		probably null	Het
Fgd4	G	A	16: 16,422,645	T740I	probably benign	Het
Gm14124	A	T	2: 150,268,123	E244D	probably benign	Het
Gprc6a	G	T	10: 51,631,241	A64D	probably benign	Het
Gtf3c1	A	T	7: 125,654,551	V1365E	probably damaging	Het
Hdc	C	G	2: 126,597,970		probably null	Het
Igkv5-39	T	G	6: 69,900,569	I68L	possibly damaging	Het
Kcnh2	A	T	5: 24,326,638	V425D	probably damaging	Het
Kcnj12	T	C	11: 61,069,373	S166P	probably benign	Het
Krtap16-1	A	T	11: 99,985,698	C293*	probably null	Het
Map7	T	C	10: 20,261,835	V251A	probably damaging	Het
Myo7b	G	T	18: 31,967,191	L1597M	possibly damaging	Het
Nmu	T	C	5: 76,345,479	E82G	possibly damaging	Het
Nup85	T	C	11: 115,564,564		probably null	Het
Nwd2	A	G	5: 63,791,582	N166D	probably damaging	Het
Olfr667	T	A	7: 104,916,474	H274L	possibly damaging	Het
Pbrm1	C	A	14: 31,067,782	D784E	probably benign	Het
Pcdhgb1	T	A	18: 37,682,064	M536K	possibly damaging	Het
Pml	T	A	9: 58,220,368	Q698L	possibly damaging	Het
Pon1	T	C	6: 5,171,769	Y294C	probably benign	Het
Rasal2	T	C	1: 157,146,279		probably null	Het
Rims1	T	A	1: 22,483,165	H484L	probably damaging	Het
Rpia	C	A	6: 70,766,646	V274L	possibly damaging	Het
Sart1	A	G	19: 5,383,197	L424P	probably damaging	Het
Scnm1	A	C	3: 95,132,823		probably null	Het
Slfn8	T	A	11: 83,004,142	M613L	possibly damaging	Het
Snph	A	G	2: 151,593,721	V429A	probably damaging	Het
Tarbp1	T	A	8: 126,444,195	D1022V	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Ttc8	A	G	12: 98,943,335	N100D	probably benign	Het
Zbtb49	T	A	5: 38,200,653	H752L	probably benign	Het
Zfp263	T	C	16: 3,746,896		probably null	Het
Zfp46	A	G	4: 136,291,147	T431A	probably benign	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAAACCGTAAACCCTGCAG -3'
(R):5'- TCCACGGTGAATCGTCTCAC -3'

Sequencing Primer
(F):5'- AATGGGTGCTGAGGACTCC -3'
(R):5'- GCCGTCACTACTGCCACTG -3'

Posted On

2020-10-20