Incidental Mutation 'R8517:Zbtb49'
ID 656199
Institutional Source Beutler Lab
Gene Symbol Zbtb49
Ensembl Gene ENSMUSG00000029127
Gene Name zinc finger and BTB domain containing 49
Synonyms Zfp509, 4930518A03Rik
MMRRC Submission 067849-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8517 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 38347076-38377798 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38357997 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 752 (H752L)
Ref Sequence ENSEMBL: ENSMUSP00000092429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094833] [ENSMUST00000123106] [ENSMUST00000126267] [ENSMUST00000136475] [ENSMUST00000138820] [ENSMUST00000143436]
AlphaFold Q8BXX2
Predicted Effect probably benign
Transcript: ENSMUST00000094833
AA Change: H752L

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092429
Gene: ENSMUSG00000029127
AA Change: H752L

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
ZnF_C2H2 414 436 6.99e-5 SMART
ZnF_C2H2 442 464 2.24e-3 SMART
ZnF_C2H2 470 492 1.26e-2 SMART
ZnF_C2H2 498 520 5.14e-3 SMART
ZnF_C2H2 526 548 2.27e-4 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
low complexity region 597 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123106
SMART Domains Protein: ENSMUSP00000144200
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 12 51 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126267
SMART Domains Protein: ENSMUSP00000122109
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129161
Predicted Effect probably benign
Transcript: ENSMUST00000136475
SMART Domains Protein: ENSMUSP00000117174
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138820
SMART Domains Protein: ENSMUSP00000117913
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 13 63 4.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143436
SMART Domains Protein: ENSMUSP00000115513
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 15 75 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146859
SMART Domains Protein: ENSMUSP00000114955
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
ZnF_C2H2 11 33 1.26e-2 SMART
ZnF_C2H2 39 61 5.14e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,206 (GRCm39) D131E probably damaging Het
Abca17 C A 17: 24,536,207 (GRCm39) V487F probably benign Het
Anapc5 T C 5: 122,959,093 (GRCm39) S41G probably benign Het
Aoc1 C T 6: 48,883,644 (GRCm39) Q507* probably null Het
Ccdc171 G A 4: 83,661,298 (GRCm39) R1136H probably damaging Het
Clspn A G 4: 126,460,012 (GRCm39) D413G probably benign Het
Copz2 A G 11: 96,744,309 (GRCm39) K74E possibly damaging Het
Cpsf4l C A 11: 113,599,651 (GRCm39) A45S probably benign Het
Cr2 T C 1: 194,838,207 (GRCm39) I710V probably benign Het
Csmd2 G A 4: 128,446,479 (GRCm39) R3348Q Het
Dchs2 A G 3: 83,178,419 (GRCm39) I1157M probably damaging Het
Dcst1 A G 3: 89,272,455 (GRCm39) F3L probably benign Het
Dennd5b A C 6: 148,930,619 (GRCm39) C743G probably damaging Het
Dnah6 T C 6: 73,155,440 (GRCm39) E725G probably benign Het
Dnajc3 G T 14: 119,190,589 (GRCm39) G51* probably null Het
Dyrk2 T C 10: 118,696,926 (GRCm39) T111A probably benign Het
F5 T A 1: 164,003,822 (GRCm39) F206I probably damaging Het
Fam217b T A 2: 178,062,565 (GRCm39) S176R probably benign Het
Farsb A T 1: 78,439,933 (GRCm39) L313* probably null Het
Fbh1 A G 2: 11,782,241 (GRCm39) probably null Het
Fgd4 G A 16: 16,240,509 (GRCm39) T740I probably benign Het
Gprc6a G T 10: 51,507,337 (GRCm39) A64D probably benign Het
Gtf3c1 A T 7: 125,253,723 (GRCm39) V1365E probably damaging Het
Hdc C G 2: 126,439,890 (GRCm39) probably null Het
Igkv5-39 T G 6: 69,877,553 (GRCm39) I68L possibly damaging Het
Kcnh2 A T 5: 24,531,636 (GRCm39) V425D probably damaging Het
Kcnj12 T C 11: 60,960,199 (GRCm39) S166P probably benign Het
Krtap16-1 A T 11: 99,876,524 (GRCm39) C293* probably null Het
Map7 T C 10: 20,137,581 (GRCm39) V251A probably damaging Het
Myo7b G T 18: 32,100,244 (GRCm39) L1597M possibly damaging Het
Nmu T C 5: 76,493,326 (GRCm39) E82G possibly damaging Het
Nup85 T C 11: 115,455,390 (GRCm39) probably null Het
Nwd2 A G 5: 63,948,925 (GRCm39) N166D probably damaging Het
Or52n2b T A 7: 104,565,681 (GRCm39) H274L possibly damaging Het
Pbrm1 C A 14: 30,789,739 (GRCm39) D784E probably benign Het
Pcdhgb1 T A 18: 37,815,117 (GRCm39) M536K possibly damaging Het
Pml T A 9: 58,127,651 (GRCm39) Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 (GRCm39) Y294C probably benign Het
Rasal2 T C 1: 156,973,849 (GRCm39) probably null Het
Rims1 T A 1: 22,522,246 (GRCm39) H484L probably damaging Het
Rpia C A 6: 70,743,630 (GRCm39) V274L possibly damaging Het
Sart1 A G 19: 5,433,225 (GRCm39) L424P probably damaging Het
Scnm1 A C 3: 95,040,134 (GRCm39) probably null Het
Slfn8 T A 11: 82,894,968 (GRCm39) M613L possibly damaging Het
Snph A G 2: 151,435,641 (GRCm39) V429A probably damaging Het
Tarbp1 T A 8: 127,170,934 (GRCm39) D1022V probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Ttc8 A G 12: 98,909,594 (GRCm39) N100D probably benign Het
Zfp1005 A T 2: 150,110,043 (GRCm39) E244D probably benign Het
Zfp263 T C 16: 3,564,760 (GRCm39) probably null Het
Zfp46 A G 4: 136,018,458 (GRCm39) T431A probably benign Het
Other mutations in Zbtb49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Zbtb49 APN 5 38,367,960 (GRCm39) critical splice donor site probably null
IGL01736:Zbtb49 APN 5 38,358,204 (GRCm39) missense probably damaging 1.00
PIT4585001:Zbtb49 UTSW 5 38,373,820 (GRCm39) missense probably damaging 1.00
R0443:Zbtb49 UTSW 5 38,358,174 (GRCm39) missense probably benign 0.08
R0526:Zbtb49 UTSW 5 38,371,263 (GRCm39) missense probably benign 0.08
R0646:Zbtb49 UTSW 5 38,358,018 (GRCm39) missense probably damaging 1.00
R1200:Zbtb49 UTSW 5 38,370,675 (GRCm39) missense probably damaging 1.00
R1678:Zbtb49 UTSW 5 38,371,038 (GRCm39) missense probably damaging 0.97
R1964:Zbtb49 UTSW 5 38,361,105 (GRCm39) nonsense probably null
R2155:Zbtb49 UTSW 5 38,371,464 (GRCm39) missense possibly damaging 0.86
R2483:Zbtb49 UTSW 5 38,360,701 (GRCm39) intron probably benign
R3617:Zbtb49 UTSW 5 38,357,975 (GRCm39) unclassified probably benign
R4937:Zbtb49 UTSW 5 38,371,307 (GRCm39) missense possibly damaging 0.76
R5579:Zbtb49 UTSW 5 38,358,160 (GRCm39) missense probably damaging 0.99
R5699:Zbtb49 UTSW 5 38,373,870 (GRCm39) missense probably damaging 1.00
R6354:Zbtb49 UTSW 5 38,360,903 (GRCm39) missense possibly damaging 0.58
R6426:Zbtb49 UTSW 5 38,360,431 (GRCm39) splice site probably null
R6735:Zbtb49 UTSW 5 38,358,402 (GRCm39) missense possibly damaging 0.74
R6805:Zbtb49 UTSW 5 38,370,585 (GRCm39) intron probably benign
R6869:Zbtb49 UTSW 5 38,371,694 (GRCm39) missense probably damaging 1.00
R7020:Zbtb49 UTSW 5 38,370,711 (GRCm39) nonsense probably null
R7899:Zbtb49 UTSW 5 38,371,274 (GRCm39) nonsense probably null
R8041:Zbtb49 UTSW 5 38,358,198 (GRCm39) missense possibly damaging 0.61
R8461:Zbtb49 UTSW 5 38,358,453 (GRCm39) missense probably benign 0.04
R8523:Zbtb49 UTSW 5 38,370,669 (GRCm39) missense probably damaging 1.00
R9068:Zbtb49 UTSW 5 38,358,289 (GRCm39) missense probably benign
R9160:Zbtb49 UTSW 5 38,363,246 (GRCm39) missense probably damaging 0.99
R9301:Zbtb49 UTSW 5 38,370,931 (GRCm39) missense probably benign
R9315:Zbtb49 UTSW 5 38,358,082 (GRCm39) missense probably benign 0.05
R9480:Zbtb49 UTSW 5 38,358,409 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TAGACTGCTTCTCTGAGTTGTTGAC -3'
(R):5'- ACGCGTACTCAGATGTGGAG -3'

Sequencing Primer
(F):5'- CTCTGAGTTGTTGACTGCTGC -3'
(R):5'- TACTCAGATGTGGAGCCCTCAG -3'
Posted On 2020-10-20