Incidental Mutation 'R8517:Zbtb49'
ID 656199
Institutional Source Beutler Lab
Gene Symbol Zbtb49
Ensembl Gene ENSMUSG00000029127
Gene Name zinc finger and BTB domain containing 49
Synonyms Zfp509, 4930518A03Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R8517 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 38189735-38220457 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38200653 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 752 (H752L)
Ref Sequence ENSEMBL: ENSMUSP00000092429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094833] [ENSMUST00000123106] [ENSMUST00000126267] [ENSMUST00000136475] [ENSMUST00000138820] [ENSMUST00000143436]
AlphaFold Q8BXX2
Predicted Effect probably benign
Transcript: ENSMUST00000094833
AA Change: H752L

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092429
Gene: ENSMUSG00000029127
AA Change: H752L

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
ZnF_C2H2 414 436 6.99e-5 SMART
ZnF_C2H2 442 464 2.24e-3 SMART
ZnF_C2H2 470 492 1.26e-2 SMART
ZnF_C2H2 498 520 5.14e-3 SMART
ZnF_C2H2 526 548 2.27e-4 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
low complexity region 597 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123106
SMART Domains Protein: ENSMUSP00000144200
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 12 51 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126267
SMART Domains Protein: ENSMUSP00000122109
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129161
Predicted Effect probably benign
Transcript: ENSMUST00000136475
SMART Domains Protein: ENSMUSP00000117174
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138820
SMART Domains Protein: ENSMUSP00000117913
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 13 63 4.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143436
SMART Domains Protein: ENSMUSP00000115513
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 15 75 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146859
SMART Domains Protein: ENSMUSP00000114955
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
ZnF_C2H2 11 33 1.26e-2 SMART
ZnF_C2H2 39 61 5.14e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,969 D131E probably damaging Het
Abca17 C A 17: 24,317,233 V487F probably benign Het
Anapc5 T C 5: 122,821,030 S41G probably benign Het
Aoc1 C T 6: 48,906,710 Q507* probably null Het
Ccdc171 G A 4: 83,743,061 R1136H probably damaging Het
Clspn A G 4: 126,566,219 D413G probably benign Het
Copz2 A G 11: 96,853,483 K74E possibly damaging Het
Cpsf4l C A 11: 113,708,825 A45S probably benign Het
Cr2 T C 1: 195,155,899 I710V probably benign Het
Csmd2 G A 4: 128,552,686 R3348Q Het
Dchs2 A G 3: 83,271,112 I1157M probably damaging Het
Dcst1 A G 3: 89,365,148 F3L probably benign Het
Dennd5b A C 6: 149,029,121 C743G probably damaging Het
Dnah6 T C 6: 73,178,457 E725G probably benign Het
Dnajc3 G T 14: 118,953,177 G51* probably null Het
Dyrk2 T C 10: 118,861,021 T111A probably benign Het
F5 T A 1: 164,176,253 F206I probably damaging Het
Fam217b T A 2: 178,420,772 S176R probably benign Het
Farsb A T 1: 78,463,296 L313* probably null Het
Fbxo18 A G 2: 11,777,430 probably null Het
Fgd4 G A 16: 16,422,645 T740I probably benign Het
Gm14124 A T 2: 150,268,123 E244D probably benign Het
Gprc6a G T 10: 51,631,241 A64D probably benign Het
Gtf3c1 A T 7: 125,654,551 V1365E probably damaging Het
Hdc C G 2: 126,597,970 probably null Het
Igkv5-39 T G 6: 69,900,569 I68L possibly damaging Het
Kcnh2 A T 5: 24,326,638 V425D probably damaging Het
Kcnj12 T C 11: 61,069,373 S166P probably benign Het
Krtap16-1 A T 11: 99,985,698 C293* probably null Het
Map7 T C 10: 20,261,835 V251A probably damaging Het
Myo7b G T 18: 31,967,191 L1597M possibly damaging Het
Nmu T C 5: 76,345,479 E82G possibly damaging Het
Nup85 T C 11: 115,564,564 probably null Het
Nwd2 A G 5: 63,791,582 N166D probably damaging Het
Olfr667 T A 7: 104,916,474 H274L possibly damaging Het
Pbrm1 C A 14: 31,067,782 D784E probably benign Het
Pcdhgb1 T A 18: 37,682,064 M536K possibly damaging Het
Pml T A 9: 58,220,368 Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 Y294C probably benign Het
Rasal2 T C 1: 157,146,279 probably null Het
Rims1 T A 1: 22,483,165 H484L probably damaging Het
Rpia C A 6: 70,766,646 V274L possibly damaging Het
Sart1 A G 19: 5,383,197 L424P probably damaging Het
Scnm1 A C 3: 95,132,823 probably null Het
Slfn8 T A 11: 83,004,142 M613L possibly damaging Het
Snph A G 2: 151,593,721 V429A probably damaging Het
Tarbp1 T A 8: 126,444,195 D1022V probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ttc8 A G 12: 98,943,335 N100D probably benign Het
Zfp263 T C 16: 3,746,896 probably null Het
Zfp46 A G 4: 136,291,147 T431A probably benign Het
Other mutations in Zbtb49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Zbtb49 APN 5 38210616 critical splice donor site probably null
IGL01736:Zbtb49 APN 5 38200860 missense probably damaging 1.00
PIT4585001:Zbtb49 UTSW 5 38216476 missense probably damaging 1.00
R0443:Zbtb49 UTSW 5 38200830 missense probably benign 0.08
R0526:Zbtb49 UTSW 5 38213919 missense probably benign 0.08
R0646:Zbtb49 UTSW 5 38200674 missense probably damaging 1.00
R1200:Zbtb49 UTSW 5 38213331 missense probably damaging 1.00
R1678:Zbtb49 UTSW 5 38213694 missense probably damaging 0.97
R1964:Zbtb49 UTSW 5 38203761 nonsense probably null
R2155:Zbtb49 UTSW 5 38214120 missense possibly damaging 0.86
R2483:Zbtb49 UTSW 5 38203357 intron probably benign
R3617:Zbtb49 UTSW 5 38200631 unclassified probably benign
R4937:Zbtb49 UTSW 5 38213963 missense possibly damaging 0.76
R5579:Zbtb49 UTSW 5 38200816 missense probably damaging 0.99
R5699:Zbtb49 UTSW 5 38216526 missense probably damaging 1.00
R6354:Zbtb49 UTSW 5 38203559 missense possibly damaging 0.58
R6426:Zbtb49 UTSW 5 38203087 splice site probably null
R6735:Zbtb49 UTSW 5 38201058 missense possibly damaging 0.74
R6805:Zbtb49 UTSW 5 38213241 intron probably benign
R6869:Zbtb49 UTSW 5 38214350 missense probably damaging 1.00
R7020:Zbtb49 UTSW 5 38213367 nonsense probably null
R7899:Zbtb49 UTSW 5 38213930 nonsense probably null
R8041:Zbtb49 UTSW 5 38200854 missense possibly damaging 0.61
R8461:Zbtb49 UTSW 5 38201109 missense probably benign 0.04
R8523:Zbtb49 UTSW 5 38213325 missense probably damaging 1.00
R9068:Zbtb49 UTSW 5 38200945 missense probably benign
R9160:Zbtb49 UTSW 5 38205902 missense probably damaging 0.99
R9301:Zbtb49 UTSW 5 38213587 missense probably benign
R9315:Zbtb49 UTSW 5 38200738 missense probably benign 0.05
R9480:Zbtb49 UTSW 5 38201065 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TAGACTGCTTCTCTGAGTTGTTGAC -3'
(R):5'- ACGCGTACTCAGATGTGGAG -3'

Sequencing Primer
(F):5'- CTCTGAGTTGTTGACTGCTGC -3'
(R):5'- TACTCAGATGTGGAGCCCTCAG -3'
Posted On 2020-10-20