Incidental Mutation 'R8517:Tarbp1'
ID656211
Institutional Source Beutler Lab
Gene Symbol Tarbp1
Ensembl Gene ENSMUSG00000090290
Gene NameTAR RNA binding protein 1
SynonymsGm17296
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8517 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location126425329-126475065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126444195 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1022 (D1022V)
Ref Sequence ENSEMBL: ENSMUSP00000129815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170518]
Predicted Effect probably benign
Transcript: ENSMUST00000170518
AA Change: D1022V

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: D1022V

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
low complexity region 77 97 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
SCOP:d1gw5a_ 1059 1260 3e-3 SMART
Pfam:SpoU_methylase 1421 1564 2.2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,969 D131E probably damaging Het
Abca17 C A 17: 24,317,233 V487F probably benign Het
Anapc5 T C 5: 122,821,030 S41G probably benign Het
Aoc1 C T 6: 48,906,710 Q507* probably null Het
Ccdc171 G A 4: 83,743,061 R1136H probably damaging Het
Clspn A G 4: 126,566,219 D413G probably benign Het
Copz2 A G 11: 96,853,483 K74E possibly damaging Het
Cpsf4l C A 11: 113,708,825 A45S probably benign Het
Cr2 T C 1: 195,155,899 I710V probably benign Het
Csmd2 G A 4: 128,552,686 R3348Q Het
Dchs2 A G 3: 83,271,112 I1157M probably damaging Het
Dcst1 A G 3: 89,365,148 F3L probably benign Het
Dennd5b A C 6: 149,029,121 C743G probably damaging Het
Dnah6 T C 6: 73,178,457 E725G probably benign Het
Dnajc3 G T 14: 118,953,177 G51* probably null Het
Dyrk2 T C 10: 118,861,021 T111A probably benign Het
F5 T A 1: 164,176,253 F206I probably damaging Het
Fam217b T A 2: 178,420,772 S176R probably benign Het
Farsb A T 1: 78,463,296 L313* probably null Het
Fbxo18 A G 2: 11,777,430 probably null Het
Fgd4 G A 16: 16,422,645 T740I probably benign Het
Gm14124 A T 2: 150,268,123 E244D probably benign Het
Gprc6a G T 10: 51,631,241 A64D probably benign Het
Gtf3c1 A T 7: 125,654,551 V1365E probably damaging Het
Hdc C G 2: 126,597,970 probably null Het
Igkv5-39 T G 6: 69,900,569 I68L possibly damaging Het
Kcnh2 A T 5: 24,326,638 V425D probably damaging Het
Kcnj12 T C 11: 61,069,373 S166P probably benign Het
Krtap16-1 A T 11: 99,985,698 C293* probably null Het
Map7 T C 10: 20,261,835 V251A probably damaging Het
Myo7b G T 18: 31,967,191 L1597M possibly damaging Het
Nmu T C 5: 76,345,479 E82G possibly damaging Het
Nup85 T C 11: 115,564,564 probably null Het
Nwd2 A G 5: 63,791,582 N166D probably damaging Het
Olfr667 T A 7: 104,916,474 H274L possibly damaging Het
Pbrm1 C A 14: 31,067,782 D784E probably benign Het
Pcdhgb1 T A 18: 37,682,064 M536K possibly damaging Het
Pml T A 9: 58,220,368 Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 Y294C probably benign Het
Rasal2 T C 1: 157,146,279 probably null Het
Rims1 T A 1: 22,483,165 H484L probably damaging Het
Rpia C A 6: 70,766,646 V274L possibly damaging Het
Sart1 A G 19: 5,383,197 L424P probably damaging Het
Scnm1 A C 3: 95,132,823 probably null Het
Slfn8 T A 11: 83,004,142 M613L possibly damaging Het
Snph A G 2: 151,593,721 V429A probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ttc8 A G 12: 98,943,335 N100D probably benign Het
Zbtb49 T A 5: 38,200,653 H752L probably benign Het
Zfp263 T C 16: 3,746,896 probably null Het
Zfp46 A G 4: 136,291,147 T431A probably benign Het
Other mutations in Tarbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tarbp1 APN 8 126459161 missense probably damaging 1.00
IGL01419:Tarbp1 APN 8 126428155 missense probably benign 0.03
IGL01475:Tarbp1 APN 8 126433962 missense probably benign 0.03
IGL01688:Tarbp1 APN 8 126447551 missense probably damaging 1.00
IGL01772:Tarbp1 APN 8 126447231 splice site probably benign
IGL02402:Tarbp1 APN 8 126450828 splice site probably benign
IGL02899:Tarbp1 APN 8 126453844 missense probably damaging 0.96
IGL03006:Tarbp1 APN 8 126444142 missense probably damaging 1.00
IGL03273:Tarbp1 APN 8 126453835 missense probably damaging 1.00
PIT4280001:Tarbp1 UTSW 8 126430847 missense probably damaging 0.96
R0048:Tarbp1 UTSW 8 126447530 missense probably damaging 1.00
R0309:Tarbp1 UTSW 8 126438928 splice site probably benign
R0383:Tarbp1 UTSW 8 126447484 missense probably benign 0.00
R0455:Tarbp1 UTSW 8 126440873 missense probably benign 0.00
R0738:Tarbp1 UTSW 8 126438801 critical splice donor site probably null
R1345:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1370:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1617:Tarbp1 UTSW 8 126444268 missense possibly damaging 0.47
R1628:Tarbp1 UTSW 8 126430860 missense possibly damaging 0.78
R1702:Tarbp1 UTSW 8 126428218 missense probably damaging 1.00
R1873:Tarbp1 UTSW 8 126447047 missense probably damaging 1.00
R2018:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2019:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2060:Tarbp1 UTSW 8 126447594 splice site probably null
R2877:Tarbp1 UTSW 8 126427832 missense probably damaging 1.00
R3008:Tarbp1 UTSW 8 126447421 missense possibly damaging 0.46
R3875:Tarbp1 UTSW 8 126438799 splice site probably benign
R3905:Tarbp1 UTSW 8 126428152 missense probably damaging 1.00
R3923:Tarbp1 UTSW 8 126440771 missense probably benign 0.00
R4420:Tarbp1 UTSW 8 126447080 missense possibly damaging 0.59
R4570:Tarbp1 UTSW 8 126452233 missense probably benign 0.00
R4610:Tarbp1 UTSW 8 126474330 missense probably damaging 1.00
R4649:Tarbp1 UTSW 8 126447195 missense probably damaging 0.96
R4802:Tarbp1 UTSW 8 126474889 missense possibly damaging 0.75
R4951:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R4953:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R5254:Tarbp1 UTSW 8 126467156 missense probably damaging 0.96
R5255:Tarbp1 UTSW 8 126428970 missense probably benign 0.16
R5638:Tarbp1 UTSW 8 126450686 missense probably damaging 1.00
R5696:Tarbp1 UTSW 8 126447340 missense probably damaging 0.98
R5707:Tarbp1 UTSW 8 126467144 missense probably damaging 1.00
R5896:Tarbp1 UTSW 8 126452928 missense probably benign 0.05
R6087:Tarbp1 UTSW 8 126428970 missense probably benign 0.00
R6117:Tarbp1 UTSW 8 126427541 missense probably benign 0.00
R6132:Tarbp1 UTSW 8 126434809 missense probably benign 0.17
R6168:Tarbp1 UTSW 8 126448405 missense possibly damaging 0.89
R6419:Tarbp1 UTSW 8 126459044 missense possibly damaging 0.95
R6482:Tarbp1 UTSW 8 126450695 missense probably benign 0.01
R6766:Tarbp1 UTSW 8 126447400 missense probably benign 0.41
R6775:Tarbp1 UTSW 8 126436829 missense probably benign 0.16
R6960:Tarbp1 UTSW 8 126429039 missense possibly damaging 0.88
R7054:Tarbp1 UTSW 8 126474495 missense possibly damaging 0.85
R7068:Tarbp1 UTSW 8 126427034 missense probably damaging 1.00
R7454:Tarbp1 UTSW 8 126457677 missense probably benign 0.19
R7519:Tarbp1 UTSW 8 126433900 missense possibly damaging 0.87
R7760:Tarbp1 UTSW 8 126452807 missense not run
R7837:Tarbp1 UTSW 8 126474561 missense probably benign 0.00
R7882:Tarbp1 UTSW 8 126456493 missense probably damaging 1.00
R7982:Tarbp1 UTSW 8 126444301 missense probably damaging 1.00
R8166:Tarbp1 UTSW 8 126427128 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GAAGGTTTGGACATCCTGAATAAG -3'
(R):5'- GTTCTTTATAACTGACCTGGTCAAAGG -3'

Sequencing Primer
(F):5'- TGTGAGGAGAAAAAGAAAACAGGCTC -3'
(R):5'- AGGTTAACCTGAGTGTTGTGTCTC -3'
Posted On2020-10-20