Incidental Mutation 'R8517:Gprc6a'
ID 656214
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 067849-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8517 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 51507337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 64 (A64D)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: A64D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: A64D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: A64D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: A64D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,206 (GRCm39) D131E probably damaging Het
Abca17 C A 17: 24,536,207 (GRCm39) V487F probably benign Het
Anapc5 T C 5: 122,959,093 (GRCm39) S41G probably benign Het
Aoc1 C T 6: 48,883,644 (GRCm39) Q507* probably null Het
Ccdc171 G A 4: 83,661,298 (GRCm39) R1136H probably damaging Het
Clspn A G 4: 126,460,012 (GRCm39) D413G probably benign Het
Copz2 A G 11: 96,744,309 (GRCm39) K74E possibly damaging Het
Cpsf4l C A 11: 113,599,651 (GRCm39) A45S probably benign Het
Cr2 T C 1: 194,838,207 (GRCm39) I710V probably benign Het
Csmd2 G A 4: 128,446,479 (GRCm39) R3348Q Het
Dchs2 A G 3: 83,178,419 (GRCm39) I1157M probably damaging Het
Dcst1 A G 3: 89,272,455 (GRCm39) F3L probably benign Het
Dennd5b A C 6: 148,930,619 (GRCm39) C743G probably damaging Het
Dnah6 T C 6: 73,155,440 (GRCm39) E725G probably benign Het
Dnajc3 G T 14: 119,190,589 (GRCm39) G51* probably null Het
Dyrk2 T C 10: 118,696,926 (GRCm39) T111A probably benign Het
F5 T A 1: 164,003,822 (GRCm39) F206I probably damaging Het
Fam217b T A 2: 178,062,565 (GRCm39) S176R probably benign Het
Farsb A T 1: 78,439,933 (GRCm39) L313* probably null Het
Fbh1 A G 2: 11,782,241 (GRCm39) probably null Het
Fgd4 G A 16: 16,240,509 (GRCm39) T740I probably benign Het
Gtf3c1 A T 7: 125,253,723 (GRCm39) V1365E probably damaging Het
Hdc C G 2: 126,439,890 (GRCm39) probably null Het
Igkv5-39 T G 6: 69,877,553 (GRCm39) I68L possibly damaging Het
Kcnh2 A T 5: 24,531,636 (GRCm39) V425D probably damaging Het
Kcnj12 T C 11: 60,960,199 (GRCm39) S166P probably benign Het
Krtap16-1 A T 11: 99,876,524 (GRCm39) C293* probably null Het
Map7 T C 10: 20,137,581 (GRCm39) V251A probably damaging Het
Myo7b G T 18: 32,100,244 (GRCm39) L1597M possibly damaging Het
Nmu T C 5: 76,493,326 (GRCm39) E82G possibly damaging Het
Nup85 T C 11: 115,455,390 (GRCm39) probably null Het
Nwd2 A G 5: 63,948,925 (GRCm39) N166D probably damaging Het
Or52n2b T A 7: 104,565,681 (GRCm39) H274L possibly damaging Het
Pbrm1 C A 14: 30,789,739 (GRCm39) D784E probably benign Het
Pcdhgb1 T A 18: 37,815,117 (GRCm39) M536K possibly damaging Het
Pml T A 9: 58,127,651 (GRCm39) Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 (GRCm39) Y294C probably benign Het
Rasal2 T C 1: 156,973,849 (GRCm39) probably null Het
Rims1 T A 1: 22,522,246 (GRCm39) H484L probably damaging Het
Rpia C A 6: 70,743,630 (GRCm39) V274L possibly damaging Het
Sart1 A G 19: 5,433,225 (GRCm39) L424P probably damaging Het
Scnm1 A C 3: 95,040,134 (GRCm39) probably null Het
Slfn8 T A 11: 82,894,968 (GRCm39) M613L possibly damaging Het
Snph A G 2: 151,435,641 (GRCm39) V429A probably damaging Het
Tarbp1 T A 8: 127,170,934 (GRCm39) D1022V probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Ttc8 A G 12: 98,909,594 (GRCm39) N100D probably benign Het
Zbtb49 T A 5: 38,357,997 (GRCm39) H752L probably benign Het
Zfp1005 A T 2: 150,110,043 (GRCm39) E244D probably benign Het
Zfp263 T C 16: 3,564,760 (GRCm39) probably null Het
Zfp46 A G 4: 136,018,458 (GRCm39) T431A probably benign Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTCCTCTGCGCTTGGAAG -3'
(R):5'- AAGATGGCCCTATTGATTACAGTAG -3'

Sequencing Primer
(F):5'- TGGAAGCTGATTACACATATAGGAC -3'
(R):5'- GCCCTATTGATTACAGTAGTTACTTG -3'
Posted On 2020-10-20