Incidental Mutation 'R8517:Gprc6a'
ID656214
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene NameG protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8517 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location51614823-51631461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 51631241 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 64 (A64D)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: A64D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: A64D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: A64D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: A64D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,969 D131E probably damaging Het
Abca17 C A 17: 24,317,233 V487F probably benign Het
Anapc5 T C 5: 122,821,030 S41G probably benign Het
Aoc1 C T 6: 48,906,710 Q507* probably null Het
Ccdc171 G A 4: 83,743,061 R1136H probably damaging Het
Clspn A G 4: 126,566,219 D413G probably benign Het
Copz2 A G 11: 96,853,483 K74E possibly damaging Het
Cpsf4l C A 11: 113,708,825 A45S probably benign Het
Cr2 T C 1: 195,155,899 I710V probably benign Het
Csmd2 G A 4: 128,552,686 R3348Q Het
Dchs2 A G 3: 83,271,112 I1157M probably damaging Het
Dcst1 A G 3: 89,365,148 F3L probably benign Het
Dennd5b A C 6: 149,029,121 C743G probably damaging Het
Dnah6 T C 6: 73,178,457 E725G probably benign Het
Dnajc3 G T 14: 118,953,177 G51* probably null Het
Dyrk2 T C 10: 118,861,021 T111A probably benign Het
F5 T A 1: 164,176,253 F206I probably damaging Het
Fam217b T A 2: 178,420,772 S176R probably benign Het
Farsb A T 1: 78,463,296 L313* probably null Het
Fbxo18 A G 2: 11,777,430 probably null Het
Fgd4 G A 16: 16,422,645 T740I probably benign Het
Gm14124 A T 2: 150,268,123 E244D probably benign Het
Gtf3c1 A T 7: 125,654,551 V1365E probably damaging Het
Hdc C G 2: 126,597,970 probably null Het
Igkv5-39 T G 6: 69,900,569 I68L possibly damaging Het
Kcnh2 A T 5: 24,326,638 V425D probably damaging Het
Kcnj12 T C 11: 61,069,373 S166P probably benign Het
Krtap16-1 A T 11: 99,985,698 C293* probably null Het
Map7 T C 10: 20,261,835 V251A probably damaging Het
Myo7b G T 18: 31,967,191 L1597M possibly damaging Het
Nmu T C 5: 76,345,479 E82G possibly damaging Het
Nup85 T C 11: 115,564,564 probably null Het
Nwd2 A G 5: 63,791,582 N166D probably damaging Het
Olfr667 T A 7: 104,916,474 H274L possibly damaging Het
Pbrm1 C A 14: 31,067,782 D784E probably benign Het
Pcdhgb1 T A 18: 37,682,064 M536K possibly damaging Het
Pml T A 9: 58,220,368 Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 Y294C probably benign Het
Rasal2 T C 1: 157,146,279 probably null Het
Rims1 T A 1: 22,483,165 H484L probably damaging Het
Rpia C A 6: 70,766,646 V274L possibly damaging Het
Sart1 A G 19: 5,383,197 L424P probably damaging Het
Scnm1 A C 3: 95,132,823 probably null Het
Slfn8 T A 11: 83,004,142 M613L possibly damaging Het
Snph A G 2: 151,593,721 V429A probably damaging Het
Tarbp1 T A 8: 126,444,195 D1022V probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ttc8 A G 12: 98,943,335 N100D probably benign Het
Zbtb49 T A 5: 38,200,653 H752L probably benign Het
Zfp263 T C 16: 3,746,896 probably null Het
Zfp46 A G 4: 136,291,147 T431A probably benign Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTCCTCTGCGCTTGGAAG -3'
(R):5'- AAGATGGCCCTATTGATTACAGTAG -3'

Sequencing Primer
(F):5'- TGGAAGCTGATTACACATATAGGAC -3'
(R):5'- GCCCTATTGATTACAGTAGTTACTTG -3'
Posted On2020-10-20