Incidental Mutation 'R8517:Dyrk2'
ID 656215
Institutional Source Beutler Lab
Gene Symbol Dyrk2
Ensembl Gene ENSMUSG00000028630
Gene Name dual-specificity tyrosine phosphorylation regulated kinase 2
Synonyms 1810038L18Rik
MMRRC Submission 067849-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.572) question?
Stock # R8517 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 118691508-118706114 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118696926 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 111 (T111A)
Ref Sequence ENSEMBL: ENSMUSP00000004281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004281]
AlphaFold Q5U4C9
Predicted Effect probably benign
Transcript: ENSMUST00000004281
AA Change: T111A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004281
Gene: ENSMUSG00000028630
AA Change: T111A

DomainStartEndE-ValueType
S_TKc 220 533 1.16e-92 SMART
low complexity region 560 574 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,206 (GRCm39) D131E probably damaging Het
Abca17 C A 17: 24,536,207 (GRCm39) V487F probably benign Het
Anapc5 T C 5: 122,959,093 (GRCm39) S41G probably benign Het
Aoc1 C T 6: 48,883,644 (GRCm39) Q507* probably null Het
Ccdc171 G A 4: 83,661,298 (GRCm39) R1136H probably damaging Het
Clspn A G 4: 126,460,012 (GRCm39) D413G probably benign Het
Copz2 A G 11: 96,744,309 (GRCm39) K74E possibly damaging Het
Cpsf4l C A 11: 113,599,651 (GRCm39) A45S probably benign Het
Cr2 T C 1: 194,838,207 (GRCm39) I710V probably benign Het
Csmd2 G A 4: 128,446,479 (GRCm39) R3348Q Het
Dchs2 A G 3: 83,178,419 (GRCm39) I1157M probably damaging Het
Dcst1 A G 3: 89,272,455 (GRCm39) F3L probably benign Het
Dennd5b A C 6: 148,930,619 (GRCm39) C743G probably damaging Het
Dnah6 T C 6: 73,155,440 (GRCm39) E725G probably benign Het
Dnajc3 G T 14: 119,190,589 (GRCm39) G51* probably null Het
F5 T A 1: 164,003,822 (GRCm39) F206I probably damaging Het
Fam217b T A 2: 178,062,565 (GRCm39) S176R probably benign Het
Farsb A T 1: 78,439,933 (GRCm39) L313* probably null Het
Fbh1 A G 2: 11,782,241 (GRCm39) probably null Het
Fgd4 G A 16: 16,240,509 (GRCm39) T740I probably benign Het
Gprc6a G T 10: 51,507,337 (GRCm39) A64D probably benign Het
Gtf3c1 A T 7: 125,253,723 (GRCm39) V1365E probably damaging Het
Hdc C G 2: 126,439,890 (GRCm39) probably null Het
Igkv5-39 T G 6: 69,877,553 (GRCm39) I68L possibly damaging Het
Kcnh2 A T 5: 24,531,636 (GRCm39) V425D probably damaging Het
Kcnj12 T C 11: 60,960,199 (GRCm39) S166P probably benign Het
Krtap16-1 A T 11: 99,876,524 (GRCm39) C293* probably null Het
Map7 T C 10: 20,137,581 (GRCm39) V251A probably damaging Het
Myo7b G T 18: 32,100,244 (GRCm39) L1597M possibly damaging Het
Nmu T C 5: 76,493,326 (GRCm39) E82G possibly damaging Het
Nup85 T C 11: 115,455,390 (GRCm39) probably null Het
Nwd2 A G 5: 63,948,925 (GRCm39) N166D probably damaging Het
Or52n2b T A 7: 104,565,681 (GRCm39) H274L possibly damaging Het
Pbrm1 C A 14: 30,789,739 (GRCm39) D784E probably benign Het
Pcdhgb1 T A 18: 37,815,117 (GRCm39) M536K possibly damaging Het
Pml T A 9: 58,127,651 (GRCm39) Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 (GRCm39) Y294C probably benign Het
Rasal2 T C 1: 156,973,849 (GRCm39) probably null Het
Rims1 T A 1: 22,522,246 (GRCm39) H484L probably damaging Het
Rpia C A 6: 70,743,630 (GRCm39) V274L possibly damaging Het
Sart1 A G 19: 5,433,225 (GRCm39) L424P probably damaging Het
Scnm1 A C 3: 95,040,134 (GRCm39) probably null Het
Slfn8 T A 11: 82,894,968 (GRCm39) M613L possibly damaging Het
Snph A G 2: 151,435,641 (GRCm39) V429A probably damaging Het
Tarbp1 T A 8: 127,170,934 (GRCm39) D1022V probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Ttc8 A G 12: 98,909,594 (GRCm39) N100D probably benign Het
Zbtb49 T A 5: 38,357,997 (GRCm39) H752L probably benign Het
Zfp1005 A T 2: 150,110,043 (GRCm39) E244D probably benign Het
Zfp263 T C 16: 3,564,760 (GRCm39) probably null Het
Zfp46 A G 4: 136,018,458 (GRCm39) T431A probably benign Het
Other mutations in Dyrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dyrk2 APN 10 118,695,749 (GRCm39) missense probably damaging 1.00
IGL00536:Dyrk2 APN 10 118,696,097 (GRCm39) missense probably damaging 1.00
IGL01288:Dyrk2 APN 10 118,696,604 (GRCm39) missense probably damaging 1.00
IGL01375:Dyrk2 APN 10 118,696,592 (GRCm39) missense probably damaging 1.00
IGL01637:Dyrk2 APN 10 118,696,412 (GRCm39) missense probably damaging 1.00
IGL02052:Dyrk2 APN 10 118,696,448 (GRCm39) missense probably damaging 1.00
R0452:Dyrk2 UTSW 10 118,704,668 (GRCm39) missense possibly damaging 0.91
R0833:Dyrk2 UTSW 10 118,697,027 (GRCm39) missense probably benign 0.00
R0836:Dyrk2 UTSW 10 118,697,027 (GRCm39) missense probably benign 0.00
R1346:Dyrk2 UTSW 10 118,695,624 (GRCm39) missense possibly damaging 0.92
R1610:Dyrk2 UTSW 10 118,695,830 (GRCm39) missense probably benign 0.02
R2397:Dyrk2 UTSW 10 118,697,273 (GRCm39) intron probably benign
R2409:Dyrk2 UTSW 10 118,696,532 (GRCm39) missense probably benign
R2965:Dyrk2 UTSW 10 118,696,242 (GRCm39) nonsense probably null
R2966:Dyrk2 UTSW 10 118,696,242 (GRCm39) nonsense probably null
R4700:Dyrk2 UTSW 10 118,704,191 (GRCm39) missense probably benign
R4896:Dyrk2 UTSW 10 118,704,153 (GRCm39) missense probably damaging 0.96
R4978:Dyrk2 UTSW 10 118,696,252 (GRCm39) missense probably benign 0.00
R5393:Dyrk2 UTSW 10 118,695,753 (GRCm39) missense probably damaging 0.98
R5442:Dyrk2 UTSW 10 118,696,643 (GRCm39) missense possibly damaging 0.72
R5496:Dyrk2 UTSW 10 118,695,956 (GRCm39) missense probably damaging 1.00
R5810:Dyrk2 UTSW 10 118,696,245 (GRCm39) missense probably benign 0.16
R5875:Dyrk2 UTSW 10 118,696,602 (GRCm39) missense probably damaging 1.00
R5930:Dyrk2 UTSW 10 118,696,173 (GRCm39) missense probably damaging 1.00
R6877:Dyrk2 UTSW 10 118,696,328 (GRCm39) missense probably damaging 1.00
R7234:Dyrk2 UTSW 10 118,696,136 (GRCm39) missense possibly damaging 0.84
R7442:Dyrk2 UTSW 10 118,695,786 (GRCm39) missense probably damaging 1.00
R7741:Dyrk2 UTSW 10 118,695,594 (GRCm39) missense probably benign
R8108:Dyrk2 UTSW 10 118,695,734 (GRCm39) missense probably benign 0.27
R8137:Dyrk2 UTSW 10 118,695,789 (GRCm39) missense probably benign 0.00
R8347:Dyrk2 UTSW 10 118,695,888 (GRCm39) missense probably damaging 0.99
R8507:Dyrk2 UTSW 10 118,696,567 (GRCm39) missense probably damaging 1.00
R8695:Dyrk2 UTSW 10 118,696,922 (GRCm39) missense probably benign 0.00
R9018:Dyrk2 UTSW 10 118,696,014 (GRCm39) missense probably damaging 0.99
R9619:Dyrk2 UTSW 10 118,696,292 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATGGTGTTCGAAGGCTG -3'
(R):5'- GGGTTAACAGGGACTTTTCAAAAG -3'

Sequencing Primer
(F):5'- CGAAGGCTGTGAGTTTTTGCATG -3'
(R):5'- AGTCATCCTTGGAGAGACGC -3'
Posted On 2020-10-20