Incidental Mutation 'R8517:Abca17'
ID656227
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene NameATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8517 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24264259-24351029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24317233 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 487 (V487F)
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
Predicted Effect probably benign
Transcript: ENSMUST00000039324
AA Change: V487F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: V487F

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121226
AA Change: V487F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: V487F

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,969 D131E probably damaging Het
Anapc5 T C 5: 122,821,030 S41G probably benign Het
Aoc1 C T 6: 48,906,710 Q507* probably null Het
Ccdc171 G A 4: 83,743,061 R1136H probably damaging Het
Clspn A G 4: 126,566,219 D413G probably benign Het
Copz2 A G 11: 96,853,483 K74E possibly damaging Het
Cpsf4l C A 11: 113,708,825 A45S probably benign Het
Cr2 T C 1: 195,155,899 I710V probably benign Het
Csmd2 G A 4: 128,552,686 R3348Q Het
Dchs2 A G 3: 83,271,112 I1157M probably damaging Het
Dcst1 A G 3: 89,365,148 F3L probably benign Het
Dennd5b A C 6: 149,029,121 C743G probably damaging Het
Dnah6 T C 6: 73,178,457 E725G probably benign Het
Dnajc3 G T 14: 118,953,177 G51* probably null Het
Dyrk2 T C 10: 118,861,021 T111A probably benign Het
F5 T A 1: 164,176,253 F206I probably damaging Het
Fam217b T A 2: 178,420,772 S176R probably benign Het
Farsb A T 1: 78,463,296 L313* probably null Het
Fbxo18 A G 2: 11,777,430 probably null Het
Fgd4 G A 16: 16,422,645 T740I probably benign Het
Gm14124 A T 2: 150,268,123 E244D probably benign Het
Gprc6a G T 10: 51,631,241 A64D probably benign Het
Gtf3c1 A T 7: 125,654,551 V1365E probably damaging Het
Hdc C G 2: 126,597,970 probably null Het
Igkv5-39 T G 6: 69,900,569 I68L possibly damaging Het
Kcnh2 A T 5: 24,326,638 V425D probably damaging Het
Kcnj12 T C 11: 61,069,373 S166P probably benign Het
Krtap16-1 A T 11: 99,985,698 C293* probably null Het
Map7 T C 10: 20,261,835 V251A probably damaging Het
Myo7b G T 18: 31,967,191 L1597M possibly damaging Het
Nmu T C 5: 76,345,479 E82G possibly damaging Het
Nup85 T C 11: 115,564,564 probably null Het
Nwd2 A G 5: 63,791,582 N166D probably damaging Het
Olfr667 T A 7: 104,916,474 H274L possibly damaging Het
Pbrm1 C A 14: 31,067,782 D784E probably benign Het
Pcdhgb1 T A 18: 37,682,064 M536K possibly damaging Het
Pml T A 9: 58,220,368 Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 Y294C probably benign Het
Rasal2 T C 1: 157,146,279 probably null Het
Rims1 T A 1: 22,483,165 H484L probably damaging Het
Rpia C A 6: 70,766,646 V274L possibly damaging Het
Sart1 A G 19: 5,383,197 L424P probably damaging Het
Scnm1 A C 3: 95,132,823 probably null Het
Slfn8 T A 11: 83,004,142 M613L possibly damaging Het
Snph A G 2: 151,593,721 V429A probably damaging Het
Tarbp1 T A 8: 126,444,195 D1022V probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ttc8 A G 12: 98,943,335 N100D probably benign Het
Zbtb49 T A 5: 38,200,653 H752L probably benign Het
Zfp263 T C 16: 3,746,896 probably null Het
Zfp46 A G 4: 136,291,147 T431A probably benign Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24265533 missense probably damaging 1.00
R8039:Abca17 UTSW 17 24328725 missense probably damaging 1.00
R8095:Abca17 UTSW 17 24317222 missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24267683 missense probably damaging 1.00
R8811:Abca17 UTSW 17 24317238 missense probably benign 0.09
R8819:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8820:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8953:Abca17 UTSW 17 24299041 missense probably benign
RF024:Abca17 UTSW 17 24287732 frame shift probably null
RF029:Abca17 UTSW 17 24287727 critical splice donor site probably benign
RF032:Abca17 UTSW 17 24287727 frame shift probably null
RF036:Abca17 UTSW 17 24287727 critical splice donor site probably benign
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCTTAGAGGGTTGTTTCTCAAGTC -3'
(R):5'- GGCCTGCCAGGGATTATAGATG -3'

Sequencing Primer
(F):5'- TCCTGTAGAGGAAATTAGAAAGCC -3'
(R):5'- CCTGCCAGGGATTATAGATGATCTAG -3'
Posted On2020-10-20