Mutagenetix > Incidental Mutation

Incidental Mutation 'R8517:Tcof1'

656230

Institutional Source

Beutler Lab

Gene Symbol

Tcof1

Ensembl Gene

ENSMUSG00000024613

Gene Name

treacle ribosome biogenesis factor 1

Synonyms

treacle

MMRRC Submission

067849-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8517 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60813755-60848971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 60829051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glycine at position 702 (A702G)

Ref Sequence

ENSEMBL: ENSMUSP00000130454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]

AlphaFold

O08784

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163446
AA Change: A702G

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613
AA Change: A702G

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
Pfam:Treacle	108	322	2.2e-8	PFAM
Pfam:Treacle	321	793	4.6e-204	PFAM
low complexity region	819	834	N/A	INTRINSIC
low complexity region	855	874	N/A	INTRINSIC
low complexity region	879	893	N/A	INTRINSIC
low complexity region	916	927	N/A	INTRINSIC
low complexity region	967	977	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000175934
AA Change: A702G

SMART Domains

Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613
AA Change: A702G

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
low complexity region	75	109	N/A	INTRINSIC
Pfam:Treacle	153	329	1.6e-12	PFAM
Pfam:Treacle	321	792	6.1e-175	PFAM
Pfam:Treacle	782	936	3.2e-16	PFAM
low complexity region	969	982	N/A	INTRINSIC
low complexity region	1025	1039	N/A	INTRINSIC
low complexity region	1060	1074	N/A	INTRINSIC
low complexity region	1149	1172	N/A	INTRINSIC
low complexity region	1260	1285	N/A	INTRINSIC
coiled coil region	1306	1335	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000176630
AA Change: A702G

SMART Domains

Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613
AA Change: A702G

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
Pfam:Treacle	108	323	2.5e-8	PFAM
Pfam:Treacle	321	793	5.9e-204	PFAM
low complexity region	819	834	N/A	INTRINSIC
low complexity region	843	857	N/A	INTRINSIC
low complexity region	880	891	N/A	INTRINSIC
low complexity region	933	946	N/A	INTRINSIC
low complexity region	989	1003	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1113	1136	N/A	INTRINSIC
low complexity region	1224	1249	N/A	INTRINSIC
coiled coil region	1270	1299	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000177172
AA Change: A654G

SMART Domains

Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613
AA Change: A654G

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
low complexity region	75	109	N/A	INTRINSIC
Pfam:Treacle	150	322	1.3e-10	PFAM
Pfam:Treacle	321	506	1.5e-78	PFAM
Pfam:Treacle	498	745	2e-105	PFAM
low complexity region	771	786	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	885	898	N/A	INTRINSIC
low complexity region	941	955	N/A	INTRINSIC
low complexity region	976	990	N/A	INTRINSIC

Meta Mutation Damage Score

0.2419

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,942,969	D131E	probably damaging	Het
Abca17	C	A	17: 24,317,233	V487F	probably benign	Het
Anapc5	T	C	5: 122,821,030	S41G	probably benign	Het
Aoc1	C	T	6: 48,906,710	Q507*	probably null	Het
Ccdc171	G	A	4: 83,743,061	R1136H	probably damaging	Het
Clspn	A	G	4: 126,566,219	D413G	probably benign	Het
Copz2	A	G	11: 96,853,483	K74E	possibly damaging	Het
Cpsf4l	C	A	11: 113,708,825	A45S	probably benign	Het
Cr2	T	C	1: 195,155,899	I710V	probably benign	Het
Csmd2	G	A	4: 128,552,686	R3348Q		Het
Dchs2	A	G	3: 83,271,112	I1157M	probably damaging	Het
Dcst1	A	G	3: 89,365,148	F3L	probably benign	Het
Dennd5b	A	C	6: 149,029,121	C743G	probably damaging	Het
Dnah6	T	C	6: 73,178,457	E725G	probably benign	Het
Dnajc3	G	T	14: 118,953,177	G51*	probably null	Het
Dyrk2	T	C	10: 118,861,021	T111A	probably benign	Het
F5	T	A	1: 164,176,253	F206I	probably damaging	Het
Fam217b	T	A	2: 178,420,772	S176R	probably benign	Het
Farsb	A	T	1: 78,463,296	L313*	probably null	Het
Fbxo18	A	G	2: 11,777,430		probably null	Het
Fgd4	G	A	16: 16,422,645	T740I	probably benign	Het
Gm14124	A	T	2: 150,268,123	E244D	probably benign	Het
Gprc6a	G	T	10: 51,631,241	A64D	probably benign	Het
Gtf3c1	A	T	7: 125,654,551	V1365E	probably damaging	Het
Hdc	C	G	2: 126,597,970		probably null	Het
Igkv5-39	T	G	6: 69,900,569	I68L	possibly damaging	Het
Kcnh2	A	T	5: 24,326,638	V425D	probably damaging	Het
Kcnj12	T	C	11: 61,069,373	S166P	probably benign	Het
Krtap16-1	A	T	11: 99,985,698	C293*	probably null	Het
Map7	T	C	10: 20,261,835	V251A	probably damaging	Het
Myo7b	G	T	18: 31,967,191	L1597M	possibly damaging	Het
Nmu	T	C	5: 76,345,479	E82G	possibly damaging	Het
Nup85	T	C	11: 115,564,564		probably null	Het
Nwd2	A	G	5: 63,791,582	N166D	probably damaging	Het
Olfr667	T	A	7: 104,916,474	H274L	possibly damaging	Het
Pbrm1	C	A	14: 31,067,782	D784E	probably benign	Het
Pcdhgb1	T	A	18: 37,682,064	M536K	possibly damaging	Het
Pml	T	A	9: 58,220,368	Q698L	possibly damaging	Het
Pon1	T	C	6: 5,171,769	Y294C	probably benign	Het
Rasal2	T	C	1: 157,146,279		probably null	Het
Rims1	T	A	1: 22,483,165	H484L	probably damaging	Het
Rpia	C	A	6: 70,766,646	V274L	possibly damaging	Het
Sart1	A	G	19: 5,383,197	L424P	probably damaging	Het
Scnm1	A	C	3: 95,132,823		probably null	Het
Slfn8	T	A	11: 83,004,142	M613L	possibly damaging	Het
Snph	A	G	2: 151,593,721	V429A	probably damaging	Het
Tarbp1	T	A	8: 126,444,195	D1022V	probably benign	Het
Ttc8	A	G	12: 98,943,335	N100D	probably benign	Het
Zbtb49	T	A	5: 38,200,653	H752L	probably benign	Het
Zfp263	T	C	16: 3,746,896		probably null	Het
Zfp46	A	G	4: 136,291,147	T431A	probably benign	Het

Other mutations in Tcof1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tcof1	APN	18	60814568	unclassified	probably benign
IGL01339:Tcof1	APN	18	60818095	utr 3 prime	probably benign
IGL02072:Tcof1	APN	18	60831565	missense	possibly damaging	0.85
IGL02160:Tcof1	APN	18	60848743	unclassified	probably benign
IGL02513:Tcof1	APN	18	60831778	missense	possibly damaging	0.51
IGL02823:Tcof1	APN	18	60816048	missense	probably benign	0.00
IGL03161:Tcof1	APN	18	60833488	missense	possibly damaging	0.86
IGL03291:Tcof1	APN	18	60829061	missense	possibly damaging	0.71
FR4304:Tcof1	UTSW	18	60835742	unclassified	probably benign
FR4589:Tcof1	UTSW	18	60828650	critical splice donor site	probably benign
FR4737:Tcof1	UTSW	18	60828650	critical splice donor site	probably benign
PIT4802001:Tcof1	UTSW	18	60831938	missense	unknown
R0569:Tcof1	UTSW	18	60829035	missense	possibly damaging	0.85
R0602:Tcof1	UTSW	18	60833533	missense	probably damaging	1.00
R0744:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0782:Tcof1	UTSW	18	60816280	missense	probably damaging	0.97
R0833:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0836:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0885:Tcof1	UTSW	18	60835850	missense	possibly damaging	0.84
R1465:Tcof1	UTSW	18	60818954	splice site	probably benign
R1528:Tcof1	UTSW	18	60814999	nonsense	probably null
R1643:Tcof1	UTSW	18	60816228	missense	possibly damaging	0.72
R1919:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R1920:Tcof1	UTSW	18	60838855	missense	possibly damaging	0.87
R1921:Tcof1	UTSW	18	60838855	missense	possibly damaging	0.87
R2023:Tcof1	UTSW	18	60833533	missense	probably damaging	1.00
R2108:Tcof1	UTSW	18	60835773	missense	probably damaging	0.97
R2114:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2115:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2116:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2117:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2156:Tcof1	UTSW	18	60831829	missense	possibly damaging	0.92
R2221:Tcof1	UTSW	18	60837901	missense	possibly damaging	0.51
R2229:Tcof1	UTSW	18	60832177	intron	probably benign
R2913:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R2914:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R3944:Tcof1	UTSW	18	60822837	missense	probably damaging	0.98
R3979:Tcof1	UTSW	18	60831533	missense	possibly damaging	0.71
R4049:Tcof1	UTSW	18	60832903	missense	possibly damaging	0.84
R4125:Tcof1	UTSW	18	60819601	missense	unknown
R5047:Tcof1	UTSW	18	60831914	missense	possibly damaging	0.86
R5433:Tcof1	UTSW	18	60818033	utr 3 prime	probably benign
R5546:Tcof1	UTSW	18	60831556	missense	possibly damaging	0.85
R5832:Tcof1	UTSW	18	60819539	missense	unknown
R5965:Tcof1	UTSW	18	60833418	critical splice donor site	probably null
R6301:Tcof1	UTSW	18	60828825	missense	probably damaging	0.97
R6480:Tcof1	UTSW	18	60814780	splice site	probably null
R6910:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R6911:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7105:Tcof1	UTSW	18	60843296	missense	probably damaging	1.00
R7225:Tcof1	UTSW	18	60828448	missense	unknown
R7356:Tcof1	UTSW	18	60818094	missense	unknown
R7467:Tcof1	UTSW	18	60831905	missense	unknown
R7536:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7804:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7818:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7863:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8006:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8007:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8008:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8063:Tcof1	UTSW	18	60838762	missense	probably damaging	1.00
R8192:Tcof1	UTSW	18	60843303	missense	probably damaging	1.00
R8200:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8203:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8204:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8207:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8217:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8300:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8518:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8553:Tcof1	UTSW	18	60831571	missense	possibly damaging	0.92
R8729:Tcof1	UTSW	18	60829073	missense	unknown
R8732:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8749:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R9800:Tcof1	UTSW	18	60816486	missense	unknown
RF001:Tcof1	UTSW	18	60835739	unclassified	probably benign
RF007:Tcof1	UTSW	18	60833568	small insertion	probably benign
RF009:Tcof1	UTSW	18	60835743	unclassified	probably benign
RF010:Tcof1	UTSW	18	60835744	unclassified	probably benign
RF011:Tcof1	UTSW	18	60835739	unclassified	probably benign
RF013:Tcof1	UTSW	18	60835743	unclassified	probably benign
RF015:Tcof1	UTSW	18	60833584	small insertion	probably benign
RF016:Tcof1	UTSW	18	60833575	small insertion	probably benign
RF022:Tcof1	UTSW	18	60835735	unclassified	probably benign
RF024:Tcof1	UTSW	18	60835738	unclassified	probably benign
RF027:Tcof1	UTSW	18	60835736	unclassified	probably benign
RF029:Tcof1	UTSW	18	60835735	unclassified	probably benign
RF029:Tcof1	UTSW	18	60835745	unclassified	probably benign
RF030:Tcof1	UTSW	18	60833568	small insertion	probably benign
RF030:Tcof1	UTSW	18	60833574	small insertion	probably benign
RF030:Tcof1	UTSW	18	60835723	unclassified	probably benign
RF031:Tcof1	UTSW	18	60833565	small insertion	probably benign
RF031:Tcof1	UTSW	18	60835745	unclassified	probably benign
RF035:Tcof1	UTSW	18	60833553	small insertion	probably benign
RF036:Tcof1	UTSW	18	60828408	small insertion	probably benign
RF036:Tcof1	UTSW	18	60835736	unclassified	probably benign
RF038:Tcof1	UTSW	18	60833566	small insertion	probably benign
RF040:Tcof1	UTSW	18	60828408	small insertion	probably benign
RF040:Tcof1	UTSW	18	60833583	small insertion	probably benign
RF041:Tcof1	UTSW	18	60833572	small insertion	probably benign
RF041:Tcof1	UTSW	18	60833576	small insertion	probably benign
RF043:Tcof1	UTSW	18	60833572	small insertion	probably benign
RF050:Tcof1	UTSW	18	60833579	small insertion	probably benign
RF051:Tcof1	UTSW	18	60833579	small insertion	probably benign
RF053:Tcof1	UTSW	18	60835747	unclassified	probably benign
RF056:Tcof1	UTSW	18	60833575	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833564	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833565	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833566	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833571	small insertion	probably benign
RF060:Tcof1	UTSW	18	60835744	unclassified	probably benign
RF060:Tcof1	UTSW	18	60835747	unclassified	probably benign
RF063:Tcof1	UTSW	18	60833573	small insertion	probably benign
RF064:Tcof1	UTSW	18	60833571	small insertion	probably benign
RF064:Tcof1	UTSW	18	60833574	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTCCCTGAATCGAGAGGTGG -3'
(R):5'- ACACTGCTGTTAGTTGGAAGG -3'

Sequencing Primer
(F):5'- AAAGGGCGGCAGTCATCC -3'
(R):5'- CTGTTAGTTGGAAGGAGGAGCC -3'

Posted On

2020-10-20