Incidental Mutation 'R8518:Bmpr1b'
ID656241
Institutional Source Beutler Lab
Gene Symbol Bmpr1b
Ensembl Gene ENSMUSG00000052430
Gene Namebone morphogenetic protein receptor, type 1B
SynonymsBMPR-IB, Alk6, Acvrlk6, CFK-43a
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.682) question?
Stock #R8518 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location141837136-142169425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141857582 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 200 (I200M)
Ref Sequence ENSEMBL: ENSMUSP00000029948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029948] [ENSMUST00000098568] [ENSMUST00000106230] [ENSMUST00000106232] [ENSMUST00000131273]
PDB Structure
Crystal structure of the GDF-5:BMP receptor IB complex. [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029948
AA Change: I200M

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029948
Gene: ENSMUSG00000052430
AA Change: I200M

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000098568
AA Change: I200M

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096167
Gene: ENSMUSG00000052430
AA Change: I200M

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000106230
AA Change: I200M

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101837
Gene: ENSMUSG00000052430
AA Change: I200M

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000106232
AA Change: I200M

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101839
Gene: ENSMUSG00000052430
AA Change: I200M

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131273
SMART Domains Protein: ENSMUSP00000117478
Gene: ENSMUSG00000052430

DomainStartEndE-ValueType
PDB:3EVS|C 13 47 1e-18 PDB
SCOP:d1es7b_ 28 47 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine/threonine kinase that functions as a receptor for bone morphogenetic proteins (BMPs). The encoded protein is a type I receptor, and forms a complex of two type II and two type I receptors at the cell membrane. This complex signals downstream to activate SMAD transcriptional regulators. This signaling is important in skeletal and bone development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mutantions of this gene affect the shape of the distal limb skeleton resulting in brachydactyly or failure to generate digit cartilage. Furthermore, inactivation results in female sterility due to abnormal oestrus cyclicity as well as retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,265,238 L192P possibly damaging Het
Abcc5 A G 16: 20,404,648 V170A possibly damaging Het
Adamts2 A G 11: 50,776,130 E418G probably damaging Het
Adra2b T C 2: 127,364,136 L191P probably damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Bag2 T C 1: 33,748,277 I55V probably benign Het
Cacna1i C A 15: 80,358,894 Y417* probably null Het
Cdc7 T A 5: 106,972,998 I162N probably damaging Het
Chchd1 T C 14: 20,704,143 I89T probably benign Het
Cxcl16 T C 11: 70,455,684 N224S probably benign Het
Dync1i1 T G 6: 5,913,330 L188V probably damaging Het
Dync2h1 A G 9: 7,051,452 V3161A probably benign Het
E2f3 T A 13: 29,913,470 K303N probably damaging Het
Fermt1 T C 2: 132,906,715 T663A probably benign Het
Fhod3 A G 18: 25,056,333 R611G probably damaging Het
Frem3 A T 8: 80,612,595 S506C probably damaging Het
Gm10318 T A 10: 77,852,878 M6K unknown Het
Gm11237 T A 4: 73,624,404 L47Q probably damaging Het
Gm6563 T A 19: 23,676,116 V90E probably damaging Het
Gpc6 T C 14: 116,925,972 S13P probably benign Het
Gpr107 C A 2: 31,176,927 H196Q probably benign Het
Heatr1 T G 13: 12,410,534 D618E probably benign Het
Lrrc27 T C 7: 139,228,774 V391A probably benign Het
Mindy3 T G 2: 12,355,343 K349N probably damaging Het
Mllt10 T C 2: 18,146,859 V261A probably damaging Het
Mrpl48 G A 7: 100,583,062 probably benign Het
Muc16 T C 9: 18,519,631 I8062V probably benign Het
Myo7a T C 7: 98,091,063 N575D possibly damaging Het
Nfrkb T C 9: 31,399,965 L370P probably damaging Het
Numbl T C 7: 27,264,936 V57A probably benign Het
Olfr1448 G A 19: 12,919,595 T238I probably damaging Het
Olfr220 T A 1: 174,449,176 C184* probably null Het
Olfr574 T C 7: 102,948,597 V44A probably damaging Het
Pdia2 A T 17: 26,198,170 L100* probably null Het
Prpf31 A T 7: 3,632,743 N105I probably damaging Het
Rbm20 A G 19: 53,851,492 N971D probably benign Het
Rnf213 T A 11: 119,462,217 M3980K Het
Skint6 A G 4: 113,238,268 F65L possibly damaging Het
Smpd4 T A 16: 17,641,020 C536S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfpt A G 7: 3,629,066 F15S possibly damaging Het
Tnp2 A G 16: 10,788,508 C32R possibly damaging Het
Tns3 A T 11: 8,492,971 V464E probably damaging Het
Tpp2 T A 1: 43,980,385 L824H probably damaging Het
Trav15-1-dv6-1 A G 14: 53,560,209 D105G probably benign Het
Ttc3 T C 16: 94,457,379 S1679P probably benign Het
Xpo7 A G 14: 70,707,397 Y19H probably damaging Het
Zswim4 G A 8: 84,211,957 R1099W probably damaging Het
Other mutations in Bmpr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Bmpr1b APN 3 141871338 missense probably damaging 1.00
IGL01394:Bmpr1b APN 3 141862981 critical splice donor site probably null
IGL02078:Bmpr1b APN 3 141870737 missense possibly damaging 0.63
IGL02315:Bmpr1b APN 3 141857529 missense probably damaging 1.00
IGL02600:Bmpr1b APN 3 141840727 missense probably damaging 1.00
IGL02709:Bmpr1b APN 3 141856553 missense probably damaging 1.00
IGL02972:Bmpr1b APN 3 141870758 missense probably benign 0.00
IGL03305:Bmpr1b APN 3 141843024 splice site probably benign
PIT4366001:Bmpr1b UTSW 3 141880463 missense probably benign
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0463:Bmpr1b UTSW 3 141857430 missense possibly damaging 0.53
R0880:Bmpr1b UTSW 3 141870796 nonsense probably null
R1449:Bmpr1b UTSW 3 141871373 missense possibly damaging 0.79
R1815:Bmpr1b UTSW 3 141880363 missense probably benign 0.03
R1852:Bmpr1b UTSW 3 141857402 critical splice donor site probably null
R1971:Bmpr1b UTSW 3 141857572 missense probably damaging 1.00
R2064:Bmpr1b UTSW 3 141870807 missense probably benign 0.00
R2299:Bmpr1b UTSW 3 141845202 missense probably damaging 1.00
R2912:Bmpr1b UTSW 3 141880378 missense probably benign 0.00
R4899:Bmpr1b UTSW 3 141840683 missense probably damaging 1.00
R4960:Bmpr1b UTSW 3 141870785 missense probably damaging 1.00
R4970:Bmpr1b UTSW 3 141845187 missense probably damaging 1.00
R5331:Bmpr1b UTSW 3 141856415 missense probably damaging 1.00
R5607:Bmpr1b UTSW 3 141857522 missense possibly damaging 0.70
R5608:Bmpr1b UTSW 3 141857522 missense possibly damaging 0.70
R5829:Bmpr1b UTSW 3 141845157 missense probably benign 0.00
R5855:Bmpr1b UTSW 3 141871385 missense possibly damaging 0.76
R5933:Bmpr1b UTSW 3 141871367 makesense probably null
R6310:Bmpr1b UTSW 3 141864536 missense probably damaging 0.97
R6469:Bmpr1b UTSW 3 141856461 missense possibly damaging 0.95
R6826:Bmpr1b UTSW 3 141857406 missense probably damaging 1.00
R7167:Bmpr1b UTSW 3 141863080 missense probably benign 0.03
R7526:Bmpr1b UTSW 3 141856599 missense probably damaging 1.00
R8136:Bmpr1b UTSW 3 141856382 missense probably damaging 1.00
Z1176:Bmpr1b UTSW 3 141842954 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCTCATGCCGCATCAGGAC -3'
(R):5'- TCAAGTAGGAGTTACTGTGAAACC -3'

Sequencing Primer
(F):5'- CAGGACCGTCTGATATATCTCAG -3'
(R):5'- TTTCTATGAAGGTTGCAATAGACAG -3'
Posted On2020-10-20