Mutagenetix > Incidental Mutations

Incidental Mutation 'R8518:Frem3'

656253

Institutional Source

Beutler Lab

Gene Symbol

Frem3

Ensembl Gene

ENSMUSG00000042353

Gene Name

Fras1 related extracellular matrix protein 3

Synonyms

LOC333315

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.127) question?

Stock #

R8518 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80611080-80695356 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80612595 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 506 (S506C)

Ref Sequence

ENSEMBL: ENSMUSP00000038015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039695]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039695
AA Change: S506C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: S506C

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Cadherin_3	369	515	9.5e-31	PFAM
Pfam:Cadherin_3	495	596	9.4e-20	PFAM
Pfam:Cadherin_3	637	786	4.2e-20	PFAM
Pfam:Cadherin_3	788	913	5.5e-23	PFAM
Pfam:Cadherin_3	998	1163	1.8e-20	PFAM
Pfam:Cadherin_3	1129	1254	1.3e-19	PFAM
Pfam:Cadherin_3	1250	1395	9.5e-34	PFAM
Pfam:Cadherin_3	1397	1508	2.7e-21	PFAM
Pfam:Cadherin_3	1493	1617	1.2e-27	PFAM
Pfam:Cadherin_3	1622	1748	4.8e-17	PFAM
Calx_beta	1754	1853	1.45e-7	SMART
Calx_beta	1866	1977	3.35e-12	SMART
Calx_beta	1991	2098	1.61e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,265,238	L192P	possibly damaging	Het
Abcc5	A	G	16: 20,404,648	V170A	possibly damaging	Het
Adamts2	A	G	11: 50,776,130	E418G	probably damaging	Het
Adra2b	T	C	2: 127,364,136	L191P	probably damaging	Het
Ampd2	C	A	3: 108,080,116	V134L	probably benign	Het
Bag2	T	C	1: 33,748,277	I55V	probably benign	Het
Bmpr1b	T	C	3: 141,857,582	I200M	possibly damaging	Het
Cacna1i	C	A	15: 80,358,894	Y417*	probably null	Het
Cdc7	T	A	5: 106,972,998	I162N	probably damaging	Het
Chchd1	T	C	14: 20,704,143	I89T	probably benign	Het
Cxcl16	T	C	11: 70,455,684	N224S	probably benign	Het
Dync1i1	T	G	6: 5,913,330	L188V	probably damaging	Het
Dync2h1	A	G	9: 7,051,452	V3161A	probably benign	Het
E2f3	T	A	13: 29,913,470	K303N	probably damaging	Het
Fermt1	T	C	2: 132,906,715	T663A	probably benign	Het
Fhod3	A	G	18: 25,056,333	R611G	probably damaging	Het
Gm10318	T	A	10: 77,852,878	M6K	unknown	Het
Gm11237	T	A	4: 73,624,404	L47Q	probably damaging	Het
Gm6563	T	A	19: 23,676,116	V90E	probably damaging	Het
Gpc6	T	C	14: 116,925,972	S13P	probably benign	Het
Gpr107	C	A	2: 31,176,927	H196Q	probably benign	Het
Heatr1	T	G	13: 12,410,534	D618E	probably benign	Het
Lrrc27	T	C	7: 139,228,774	V391A	probably benign	Het
Mindy3	T	G	2: 12,355,343	K349N	probably damaging	Het
Mllt10	T	C	2: 18,146,859	V261A	probably damaging	Het
Mrpl48	G	A	7: 100,583,062		probably benign	Het
Muc16	T	C	9: 18,519,631	I8062V	probably benign	Het
Myo7a	T	C	7: 98,091,063	N575D	possibly damaging	Het
Nfrkb	T	C	9: 31,399,965	L370P	probably damaging	Het
Numbl	T	C	7: 27,264,936	V57A	probably benign	Het
Olfr1448	G	A	19: 12,919,595	T238I	probably damaging	Het
Olfr220	T	A	1: 174,449,176	C184*	probably null	Het
Olfr574	T	C	7: 102,948,597	V44A	probably damaging	Het
Pdia2	A	T	17: 26,198,170	L100*	probably null	Het
Prpf31	A	T	7: 3,632,743	N105I	probably damaging	Het
Rbm20	A	G	19: 53,851,492	N971D	probably benign	Het
Rnf213	T	A	11: 119,462,217	M3980K		Het
Skint6	A	G	4: 113,238,268	F65L	possibly damaging	Het
Smpd4	T	A	16: 17,641,020	C536S	possibly damaging	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tfpt	A	G	7: 3,629,066	F15S	possibly damaging	Het
Tnp2	A	G	16: 10,788,508	C32R	possibly damaging	Het
Tns3	A	T	11: 8,492,971	V464E	probably damaging	Het
Tpp2	T	A	1: 43,980,385	L824H	probably damaging	Het
Trav15-1-dv6-1	A	G	14: 53,560,209	D105G	probably benign	Het
Ttc3	T	C	16: 94,457,379	S1679P	probably benign	Het
Xpo7	A	G	14: 70,707,397	Y19H	probably damaging	Het
Zswim4	G	A	8: 84,211,957	R1099W	probably damaging	Het

Other mutations in Frem3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Frem3	APN	8	80668810	missense	possibly damaging	0.75
IGL01019:Frem3	APN	8	80615134	missense	probably benign	0.02
IGL01470:Frem3	APN	8	80614315	missense	probably damaging	1.00
IGL01609:Frem3	APN	8	80612704	missense	probably benign	0.00
IGL01622:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01623:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01751:Frem3	APN	8	80615743	missense	probably benign	0.33
IGL02037:Frem3	APN	8	80611489	missense	probably benign	0.31
IGL02039:Frem3	APN	8	80612971	missense	probably damaging	1.00
IGL02084:Frem3	APN	8	80612443	missense	possibly damaging	0.95
IGL02124:Frem3	APN	8	80613094	missense	probably damaging	0.99
IGL02140:Frem3	APN	8	80614107	missense	possibly damaging	0.84
IGL02836:Frem3	APN	8	80614381	missense	probably benign
IGL03090:Frem3	APN	8	80618229	missense	probably benign	0.01
IGL03102:Frem3	APN	8	80613032	missense	possibly damaging	0.92
IGL03116:Frem3	APN	8	80612806	missense	possibly damaging	0.84
IGL03165:Frem3	APN	8	80612529	missense	probably benign	0.26
IGL03224:Frem3	APN	8	80613463	missense	probably damaging	1.00
IGL03401:Frem3	APN	8	80614541	missense	probably damaging	1.00
IGL03403:Frem3	APN	8	80611090	missense	probably benign	0.04
FR4340:Frem3	UTSW	8	80615241	small insertion	probably benign
FR4976:Frem3	UTSW	8	80615241	small insertion	probably benign
IGL02991:Frem3	UTSW	8	80668882	missense	probably damaging	1.00
IGL03052:Frem3	UTSW	8	80614530	missense	probably damaging	1.00
R0089:Frem3	UTSW	8	80615878	missense	possibly damaging	0.94
R0647:Frem3	UTSW	8	80615185	missense	probably damaging	1.00
R0690:Frem3	UTSW	8	80613952	missense	possibly damaging	0.84
R0766:Frem3	UTSW	8	80615322	missense	probably benign
R0834:Frem3	UTSW	8	80687008	missense	probably damaging	1.00
R0909:Frem3	UTSW	8	80663406	missense	probably benign	0.45
R1033:Frem3	UTSW	8	80695157	missense	probably benign	0.00
R1144:Frem3	UTSW	8	80611884	missense	probably benign	0.01
R1312:Frem3	UTSW	8	80615322	missense	probably benign
R1330:Frem3	UTSW	8	80668839	missense	probably damaging	0.99
R1355:Frem3	UTSW	8	80690702	missense	probably damaging	1.00
R1390:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R1413:Frem3	UTSW	8	80668801	missense	probably benign
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1503:Frem3	UTSW	8	80687018	missense	probably damaging	0.99
R1538:Frem3	UTSW	8	80612710	missense	probably damaging	1.00
R1538:Frem3	UTSW	8	80613135	missense	probably benign	0.00
R1612:Frem3	UTSW	8	80614861	missense	probably damaging	1.00
R1793:Frem3	UTSW	8	80613112	missense	probably benign	0.03
R1872:Frem3	UTSW	8	80612576	missense	probably damaging	1.00
R1879:Frem3	UTSW	8	80611938	nonsense	probably null
R1886:Frem3	UTSW	8	80613885	missense	probably benign	0.00
R1933:Frem3	UTSW	8	80612890	missense	probably benign	0.00
R2027:Frem3	UTSW	8	80695337	missense	possibly damaging	0.75
R2040:Frem3	UTSW	8	80615826	missense	possibly damaging	0.92
R2050:Frem3	UTSW	8	80614891	missense	probably damaging	1.00
R2079:Frem3	UTSW	8	80615103	missense	probably benign	0.03
R2099:Frem3	UTSW	8	80615859	missense	probably benign	0.06
R2120:Frem3	UTSW	8	80615457	missense	probably benign	0.20
R2842:Frem3	UTSW	8	80669349	splice site	probably null
R2845:Frem3	UTSW	8	80613220	missense	probably damaging	1.00
R3015:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R3442:Frem3	UTSW	8	80613040	missense	probably damaging	1.00
R3724:Frem3	UTSW	8	80615271	missense	probably benign	0.06
R3730:Frem3	UTSW	8	80615916	missense	probably damaging	0.99
R3939:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3940:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3941:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R4089:Frem3	UTSW	8	80615173	missense	probably damaging	1.00
R4282:Frem3	UTSW	8	80614141	missense	probably benign	0.00
R4437:Frem3	UTSW	8	80612607	missense	probably benign	0.30
R4480:Frem3	UTSW	8	80611357	missense	probably benign	0.10
R4575:Frem3	UTSW	8	80616075	missense	probably benign	0.17
R4583:Frem3	UTSW	8	80613514	missense	probably benign	0.03
R4620:Frem3	UTSW	8	80668957	missense	possibly damaging	0.82
R4621:Frem3	UTSW	8	80669191	splice site	probably null
R4644:Frem3	UTSW	8	80613727	missense	probably benign	0.33
R4667:Frem3	UTSW	8	80663420	missense	probably damaging	0.97
R4748:Frem3	UTSW	8	80611459	missense	probably damaging	1.00
R4823:Frem3	UTSW	8	80613958	missense	probably benign	0.25
R4836:Frem3	UTSW	8	80663397	missense	probably damaging	0.99
R4867:Frem3	UTSW	8	80613283	missense	probably damaging	1.00
R4921:Frem3	UTSW	8	80613136	missense	possibly damaging	0.83
R5030:Frem3	UTSW	8	80613247	missense	possibly damaging	0.89
R5035:Frem3	UTSW	8	80615914	missense	probably damaging	0.97
R5172:Frem3	UTSW	8	80612566	missense	probably benign	0.44
R5289:Frem3	UTSW	8	80612319	missense	probably benign	0.00
R5492:Frem3	UTSW	8	80612677	missense	probably damaging	1.00
R5655:Frem3	UTSW	8	80612694	missense	probably benign	0.00
R5685:Frem3	UTSW	8	80695303	missense	probably damaging	1.00
R5723:Frem3	UTSW	8	80613397	missense	probably benign	0.02
R5743:Frem3	UTSW	8	80615778	missense	probably damaging	0.98
R5889:Frem3	UTSW	8	80614288	missense	probably damaging	1.00
R6048:Frem3	UTSW	8	80613433	missense	probably benign	0.03
R6057:Frem3	UTSW	8	80615587	missense	probably damaging	0.99
R6137:Frem3	UTSW	8	80615047	missense	probably benign
R6264:Frem3	UTSW	8	80615203	missense	probably damaging	1.00
R6339:Frem3	UTSW	8	80613015	missense	possibly damaging	0.84
R6418:Frem3	UTSW	8	80611152	missense	probably benign	0.08
R6680:Frem3	UTSW	8	80669320	missense	probably damaging	1.00
R6773:Frem3	UTSW	8	80611815	missense	probably damaging	1.00
R6838:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R6928:Frem3	UTSW	8	80611282	missense	possibly damaging	0.48
R6939:Frem3	UTSW	8	80615145	missense	probably benign	0.23
R6995:Frem3	UTSW	8	80612579	missense	probably damaging	0.98
R7112:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7155:Frem3	UTSW	8	80616039	missense	probably benign	0.01
R7235:Frem3	UTSW	8	80690725	missense	probably benign	0.00
R7282:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7403:Frem3	UTSW	8	80616145	missense	probably damaging	1.00
R7422:Frem3	UTSW	8	80615763	missense	probably benign	0.00
R7485:Frem3	UTSW	8	80613336	missense	probably damaging	1.00
R7516:Frem3	UTSW	8	80612083	missense	probably damaging	0.99
R7858:Frem3	UTSW	8	80611721	nonsense	probably null
R7976:Frem3	UTSW	8	80611602	nonsense	probably null
R8171:Frem3	UTSW	8	80615240	missense	probably damaging	1.00
R8185:Frem3	UTSW	8	80612304	nonsense	probably null
R8306:Frem3	UTSW	8	80612211	missense	possibly damaging	0.95
R8478:Frem3	UTSW	8	80611558	missense	probably damaging	1.00
R8794:Frem3	UTSW	8	80612278	missense	probably damaging	1.00
R8794:Frem3	UTSW	8	80616222	missense	probably benign	0.02
R8806:Frem3	UTSW	8	80663435	missense	probably benign	0.30
R8833:Frem3	UTSW	8	80612772	missense	probably benign	0.29
R8879:Frem3	UTSW	8	80613148	missense	probably damaging	0.98
R8897:Frem3	UTSW	8	80612790	missense	probably damaging	1.00
R8983:Frem3	UTSW	8	80669246	missense	probably damaging	1.00
R9207:Frem3	UTSW	8	80613442	missense	possibly damaging	0.73
R9277:Frem3	UTSW	8	80690773	missense	probably damaging	0.96
RF030:Frem3	UTSW	8	80615238	small insertion	probably benign
RF034:Frem3	UTSW	8	80615238	small insertion	probably benign
RF042:Frem3	UTSW	8	80615238	small insertion	probably benign
X0024:Frem3	UTSW	8	80613081	missense	possibly damaging	0.76
X0027:Frem3	UTSW	8	80612388	nonsense	probably null
Z1088:Frem3	UTSW	8	80615426	missense	probably benign	0.04
Z1176:Frem3	UTSW	8	80611503	missense	probably damaging	0.99
Z1176:Frem3	UTSW	8	80615431	missense	probably benign	0.03
Z1177:Frem3	UTSW	8	80616129	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GTGTTTGAAGGCCAGGCAAG -3'
(R):5'- CCTCAGAATCAATATCGGTGGC -3'

Sequencing Primer
(F):5'- GATGCCCTAAGCTTTCAGGTCAG -3'
(R):5'- TCAATATCGGTGGCACATAAGAC -3'

Posted On

2020-10-20