Incidental Mutation 'R8518:Cacna1i'
ID 656270
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Name calcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission 067850-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8518 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 80171439-80282480 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 80243095 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 417 (Y417*)
Ref Sequence ENSEMBL: ENSMUSP00000125063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
AlphaFold E9Q7P2
Predicted Effect probably null
Transcript: ENSMUST00000160424
AA Change: Y417*
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: Y417*

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162155
AA Change: Y417*
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: Y417*

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A G 16: 20,223,398 (GRCm39) V170A possibly damaging Het
Adamts2 A G 11: 50,666,957 (GRCm39) E418G probably damaging Het
Adra2b T C 2: 127,206,056 (GRCm39) L191P probably damaging Het
Ampd2 C A 3: 107,987,432 (GRCm39) V134L probably benign Het
Bag2 T C 1: 33,787,358 (GRCm39) I55V probably benign Het
Bltp2 T C 11: 78,156,064 (GRCm39) L192P possibly damaging Het
Bmpr1b T C 3: 141,563,343 (GRCm39) I200M possibly damaging Het
Cdc7 T A 5: 107,120,864 (GRCm39) I162N probably damaging Het
Chchd1 T C 14: 20,754,211 (GRCm39) I89T probably benign Het
Cxcl16 T C 11: 70,346,510 (GRCm39) N224S probably benign Het
Dync1i1 T G 6: 5,913,330 (GRCm39) L188V probably damaging Het
Dync2h1 A G 9: 7,051,452 (GRCm39) V3161A probably benign Het
E2f3 T A 13: 30,097,453 (GRCm39) K303N probably damaging Het
Fermt1 T C 2: 132,748,635 (GRCm39) T663A probably benign Het
Fhod3 A G 18: 25,189,390 (GRCm39) R611G probably damaging Het
Frem3 A T 8: 81,339,224 (GRCm39) S506C probably damaging Het
Gm10318 T A 10: 77,688,712 (GRCm39) M6K unknown Het
Gm6563 T A 19: 23,653,480 (GRCm39) V90E probably damaging Het
Gpc6 T C 14: 117,163,384 (GRCm39) S13P probably benign Het
Gpr107 C A 2: 31,066,939 (GRCm39) H196Q probably benign Het
Heatr1 T G 13: 12,425,415 (GRCm39) D618E probably benign Het
Lrrc27 T C 7: 138,808,690 (GRCm39) V391A probably benign Het
Mindy3 T G 2: 12,360,154 (GRCm39) K349N probably damaging Het
Mllt10 T C 2: 18,151,670 (GRCm39) V261A probably damaging Het
Mrpl48 G A 7: 100,232,269 (GRCm39) probably benign Het
Msantd5f5 T A 4: 73,542,641 (GRCm39) L47Q probably damaging Het
Muc16 T C 9: 18,430,927 (GRCm39) I8062V probably benign Het
Myo7a T C 7: 97,740,270 (GRCm39) N575D possibly damaging Het
Nfrkb T C 9: 31,311,261 (GRCm39) L370P probably damaging Het
Numbl T C 7: 26,964,361 (GRCm39) V57A probably benign Het
Or51t4 T C 7: 102,597,804 (GRCm39) V44A probably damaging Het
Or5b12 G A 19: 12,896,959 (GRCm39) T238I probably damaging Het
Or6y1 T A 1: 174,276,742 (GRCm39) C184* probably null Het
Pdia2 A T 17: 26,417,144 (GRCm39) L100* probably null Het
Prpf31 A T 7: 3,635,742 (GRCm39) N105I probably damaging Het
Rbm20 A G 19: 53,839,923 (GRCm39) N971D probably benign Het
Rnf213 T A 11: 119,353,043 (GRCm39) M3980K Het
Skint6 A G 4: 113,095,465 (GRCm39) F65L possibly damaging Het
Smpd4 T A 16: 17,458,884 (GRCm39) C536S possibly damaging Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Tfpt A G 7: 3,632,065 (GRCm39) F15S possibly damaging Het
Tnp2 A G 16: 10,606,372 (GRCm39) C32R possibly damaging Het
Tns3 A T 11: 8,442,971 (GRCm39) V464E probably damaging Het
Tpp2 T A 1: 44,019,545 (GRCm39) L824H probably damaging Het
Trav15-1-dv6-1 A G 14: 53,797,666 (GRCm39) D105G probably benign Het
Ttc3 T C 16: 94,258,238 (GRCm39) S1679P probably benign Het
Xpo7 A G 14: 70,944,837 (GRCm39) Y19H probably damaging Het
Zswim4 G A 8: 84,938,586 (GRCm39) R1099W probably damaging Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80,266,220 (GRCm39) missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80,239,846 (GRCm39) missense probably benign
IGL01338:Cacna1i APN 15 80,232,581 (GRCm39) missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80,271,960 (GRCm39) splice site probably benign
IGL01669:Cacna1i APN 15 80,275,958 (GRCm39) missense probably benign
IGL01807:Cacna1i APN 15 80,258,348 (GRCm39) missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80,275,933 (GRCm39) missense probably benign 0.09
IGL01973:Cacna1i APN 15 80,266,234 (GRCm39) missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80,257,152 (GRCm39) missense probably benign 0.06
IGL02519:Cacna1i APN 15 80,246,075 (GRCm39) nonsense probably null
IGL02648:Cacna1i APN 15 80,182,839 (GRCm39) missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80,246,440 (GRCm39) missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80,239,917 (GRCm39) missense probably benign 0.30
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80,240,412 (GRCm39) missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80,256,663 (GRCm39) missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80,253,031 (GRCm39) splice site probably benign
R0637:Cacna1i UTSW 15 80,256,855 (GRCm39) missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80,265,281 (GRCm39) missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80,243,150 (GRCm39) missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80,263,255 (GRCm39) missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80,275,975 (GRCm39) splice site probably null
R1563:Cacna1i UTSW 15 80,274,056 (GRCm39) splice site probably benign
R1563:Cacna1i UTSW 15 80,205,389 (GRCm39) missense probably damaging 0.97
R1573:Cacna1i UTSW 15 80,277,869 (GRCm39) splice site probably null
R1654:Cacna1i UTSW 15 80,273,411 (GRCm39) missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80,273,323 (GRCm39) missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80,260,990 (GRCm39) missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80,243,132 (GRCm39) missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80,275,843 (GRCm39) missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80,259,465 (GRCm39) missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80,279,245 (GRCm39) missense probably benign
R2162:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80,258,968 (GRCm39) missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3702:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3832:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80,272,680 (GRCm39) missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80,253,863 (GRCm39) missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80,252,872 (GRCm39) missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80,232,650 (GRCm39) missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80,275,041 (GRCm39) missense possibly damaging 0.94
R5437:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80,255,700 (GRCm39) missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80,279,279 (GRCm39) missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80,273,333 (GRCm39) missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80,205,427 (GRCm39) missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80,220,883 (GRCm39) missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80,239,959 (GRCm39) missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80,262,448 (GRCm39) missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80,205,460 (GRCm39) missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80,259,010 (GRCm39) missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80,259,002 (GRCm39) missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80,264,671 (GRCm39) missense probably damaging 1.00
R7155:Cacna1i UTSW 15 80,279,439 (GRCm39) missense probably benign 0.04
R7274:Cacna1i UTSW 15 80,261,023 (GRCm39) missense possibly damaging 0.95
R7323:Cacna1i UTSW 15 80,275,854 (GRCm39) missense possibly damaging 0.86
R7335:Cacna1i UTSW 15 80,259,776 (GRCm39) missense probably damaging 1.00
R7571:Cacna1i UTSW 15 80,259,537 (GRCm39) missense probably damaging 1.00
R7768:Cacna1i UTSW 15 80,265,389 (GRCm39) missense probably damaging 1.00
R7820:Cacna1i UTSW 15 80,256,573 (GRCm39) missense probably benign 0.00
R7987:Cacna1i UTSW 15 80,204,553 (GRCm39) splice site probably null
R8150:Cacna1i UTSW 15 80,259,540 (GRCm39) missense probably damaging 1.00
R8206:Cacna1i UTSW 15 80,274,016 (GRCm39) splice site probably null
R8270:Cacna1i UTSW 15 80,257,835 (GRCm39) missense probably damaging 0.99
R8382:Cacna1i UTSW 15 80,261,017 (GRCm39) missense probably damaging 0.99
R8501:Cacna1i UTSW 15 80,266,247 (GRCm39) critical splice donor site probably null
R8552:Cacna1i UTSW 15 80,204,598 (GRCm39) missense possibly damaging 0.69
R8679:Cacna1i UTSW 15 80,260,011 (GRCm39) intron probably benign
R8696:Cacna1i UTSW 15 80,266,175 (GRCm39) missense probably damaging 0.98
R8887:Cacna1i UTSW 15 80,258,894 (GRCm39) missense possibly damaging 0.91
R9274:Cacna1i UTSW 15 80,254,354 (GRCm39) missense probably damaging 1.00
R9379:Cacna1i UTSW 15 80,259,495 (GRCm39) missense probably damaging 1.00
R9508:Cacna1i UTSW 15 80,279,372 (GRCm39) missense probably benign 0.06
R9518:Cacna1i UTSW 15 80,271,978 (GRCm39) missense probably damaging 1.00
R9674:Cacna1i UTSW 15 80,264,629 (GRCm39) missense probably damaging 1.00
R9747:Cacna1i UTSW 15 80,246,318 (GRCm39) missense probably benign 0.11
R9769:Cacna1i UTSW 15 80,253,793 (GRCm39) missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80,246,163 (GRCm39) missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80,246,340 (GRCm39) missense probably benign 0.03
X0058:Cacna1i UTSW 15 80,263,303 (GRCm39) missense probably damaging 1.00
Z1177:Cacna1i UTSW 15 80,273,584 (GRCm39) missense possibly damaging 0.94
Z1177:Cacna1i UTSW 15 80,265,380 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CTGCATCGCTGATCTGTCCC -3'
(R):5'- GCATGACCCACTTGCACTATT -3'

Sequencing Primer
(F):5'- TGCTGGTTCTACCCCTCTG -3'
(R):5'- TGCAGAGTCAAGGCCACTTACTG -3'
Posted On 2020-10-20