Incidental Mutation 'R8518:Rbm20'
ID656280
Institutional Source Beutler Lab
Gene Symbol Rbm20
Ensembl Gene ENSMUSG00000043639
Gene NameRNA binding motif protein 20
Synonyms2010003H22Rik, 1110018J23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R8518 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location53677306-53867080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53851492 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 971 (N971D)
Ref Sequence ENSEMBL: ENSMUSP00000129447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164202]
Predicted Effect
SMART Domains Protein: ENSMUSP00000124363
Gene: ENSMUSG00000043639
AA Change: N346D

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
low complexity region 209 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164202
AA Change: N971D

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: N971D

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_U1 410 444 6.79e-1 SMART
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
low complexity region 804 815 N/A INTRINSIC
low complexity region 833 844 N/A INTRINSIC
ZnF_U1 1130 1165 7.26e-6 SMART
ZnF_C2H2 1133 1158 3.13e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,265,238 L192P possibly damaging Het
Abcc5 A G 16: 20,404,648 V170A possibly damaging Het
Adamts2 A G 11: 50,776,130 E418G probably damaging Het
Adra2b T C 2: 127,364,136 L191P probably damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Bag2 T C 1: 33,748,277 I55V probably benign Het
Bmpr1b T C 3: 141,857,582 I200M possibly damaging Het
Cacna1i C A 15: 80,358,894 Y417* probably null Het
Cdc7 T A 5: 106,972,998 I162N probably damaging Het
Chchd1 T C 14: 20,704,143 I89T probably benign Het
Cxcl16 T C 11: 70,455,684 N224S probably benign Het
Dync1i1 T G 6: 5,913,330 L188V probably damaging Het
Dync2h1 A G 9: 7,051,452 V3161A probably benign Het
E2f3 T A 13: 29,913,470 K303N probably damaging Het
Fermt1 T C 2: 132,906,715 T663A probably benign Het
Fhod3 A G 18: 25,056,333 R611G probably damaging Het
Frem3 A T 8: 80,612,595 S506C probably damaging Het
Gm10318 T A 10: 77,852,878 M6K unknown Het
Gm11237 T A 4: 73,624,404 L47Q probably damaging Het
Gm6563 T A 19: 23,676,116 V90E probably damaging Het
Gpc6 T C 14: 116,925,972 S13P probably benign Het
Gpr107 C A 2: 31,176,927 H196Q probably benign Het
Heatr1 T G 13: 12,410,534 D618E probably benign Het
Lrrc27 T C 7: 139,228,774 V391A probably benign Het
Mindy3 T G 2: 12,355,343 K349N probably damaging Het
Mllt10 T C 2: 18,146,859 V261A probably damaging Het
Mrpl48 G A 7: 100,583,062 probably benign Het
Muc16 T C 9: 18,519,631 I8062V probably benign Het
Myo7a T C 7: 98,091,063 N575D possibly damaging Het
Nfrkb T C 9: 31,399,965 L370P probably damaging Het
Numbl T C 7: 27,264,936 V57A probably benign Het
Olfr1448 G A 19: 12,919,595 T238I probably damaging Het
Olfr220 T A 1: 174,449,176 C184* probably null Het
Olfr574 T C 7: 102,948,597 V44A probably damaging Het
Pdia2 A T 17: 26,198,170 L100* probably null Het
Prpf31 A T 7: 3,632,743 N105I probably damaging Het
Rnf213 T A 11: 119,462,217 M3980K Het
Skint6 A G 4: 113,238,268 F65L possibly damaging Het
Smpd4 T A 16: 17,641,020 C536S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfpt A G 7: 3,629,066 F15S possibly damaging Het
Tnp2 A G 16: 10,788,508 C32R possibly damaging Het
Tns3 A T 11: 8,492,971 V464E probably damaging Het
Tpp2 T A 1: 43,980,385 L824H probably damaging Het
Trav15-1-dv6-1 A G 14: 53,560,209 D105G probably benign Het
Ttc3 T C 16: 94,457,379 S1679P probably benign Het
Xpo7 A G 14: 70,707,397 Y19H probably damaging Het
Zswim4 G A 8: 84,211,957 R1099W probably damaging Het
Other mutations in Rbm20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rbm20 APN 19 53843264 missense probably damaging 1.00
IGL00815:Rbm20 APN 19 53815517 missense probably damaging 1.00
IGL00845:Rbm20 APN 19 53817949 missense probably damaging 1.00
IGL01408:Rbm20 APN 19 53851613 missense possibly damaging 0.95
IGL01663:Rbm20 APN 19 53840995 missense probably damaging 1.00
IGL01902:Rbm20 APN 19 53840991 missense probably damaging 0.99
IGL01942:Rbm20 APN 19 53813443 missense probably damaging 1.00
IGL02964:Rbm20 APN 19 53813702 missense probably benign 0.02
IGL03326:Rbm20 APN 19 53814000 missense possibly damaging 0.85
BB001:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB002:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
BB011:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB012:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R0326:Rbm20 UTSW 19 53864165 missense probably damaging 1.00
R0487:Rbm20 UTSW 19 53851195 missense probably damaging 1.00
R0965:Rbm20 UTSW 19 53859401 missense probably damaging 1.00
R1435:Rbm20 UTSW 19 53814157 missense probably benign 0.16
R1914:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R1915:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R2011:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2012:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2258:Rbm20 UTSW 19 53851741 missense probably benign
R3947:Rbm20 UTSW 19 53813337 missense probably benign 0.35
R4305:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4308:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4521:Rbm20 UTSW 19 53817202 missense probably benign 0.14
R4970:Rbm20 UTSW 19 53851669 missense probably damaging 0.99
R5266:Rbm20 UTSW 19 53813387 missense probably damaging 1.00
R5475:Rbm20 UTSW 19 53834705 nonsense probably null
R5503:Rbm20 UTSW 19 53851354 missense possibly damaging 0.75
R5995:Rbm20 UTSW 19 53851267 missense possibly damaging 0.95
R6836:Rbm20 UTSW 19 53814069 missense probably damaging 0.98
R6947:Rbm20 UTSW 19 53851265 missense probably damaging 1.00
R7030:Rbm20 UTSW 19 53834766 missense probably damaging 1.00
R7117:Rbm20 UTSW 19 53851558 missense possibly damaging 0.92
R7237:Rbm20 UTSW 19 53851499 missense probably benign 0.04
R7638:Rbm20 UTSW 19 53814333 missense possibly damaging 0.95
R7792:Rbm20 UTSW 19 53850136 missense probably benign
R7823:Rbm20 UTSW 19 53843354 missense probably benign 0.33
R7924:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
R7925:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R8044:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8045:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8046:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8100:Rbm20 UTSW 19 53851313 missense possibly damaging 0.85
R8292:Rbm20 UTSW 19 53851499 missense possibly damaging 0.71
R8366:Rbm20 UTSW 19 53850181 missense possibly damaging 0.95
RF016:Rbm20 UTSW 19 53813732 missense probably benign 0.00
Z1177:Rbm20 UTSW 19 53851685 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGTCACAGTGGACGAAG -3'
(R):5'- AGGACATTTGCTGCACTGC -3'

Sequencing Primer
(F):5'- GCTGGAAGAAATTGTGCCTATTGACC -3'
(R):5'- CAGGGGCCAGACTCACATCTG -3'
Posted On2020-10-20