Incidental Mutation 'R8017:Olfr1308'
ID656283
Institutional Source Beutler Lab
Gene Symbol Olfr1308
Ensembl Gene ENSMUSG00000074952
Gene Nameolfactory receptor 1308
SynonymsMOR245-22, GA_x6K02T2Q125-73008844-73007882
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R8017 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111959285-111964944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111960573 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 167 (P167S)
Ref Sequence ENSEMBL: ENSMUSP00000146688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099605] [ENSMUST00000207560]
Predicted Effect probably damaging
Transcript: ENSMUST00000099605
AA Change: P167S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097200
Gene: ENSMUSG00000074952
AA Change: P167S

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-39 PFAM
Pfam:7tm_1 41 287 3.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207560
AA Change: P167S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,555,956 I296S probably benign Het
Acsl5 A G 19: 55,268,796 I42V probably benign Het
Adam25 T A 8: 40,754,087 M130K possibly damaging Het
Bcl2l2 T A 14: 54,884,383 M1K probably null Het
Casc1 A G 6: 145,194,557 S173P probably damaging Het
Cdh16 T C 8: 104,616,267 N724S probably damaging Het
Cfi T C 3: 129,855,099 S211P probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Crybg2 T A 4: 134,073,173 V239E possibly damaging Het
Dcn G A 10: 97,483,535 R58Q probably damaging Het
Dnah10 A G 5: 124,800,885 N2678S probably benign Het
Fam205a1 T C 4: 42,850,840 T439A probably damaging Het
Fam214b A T 4: 43,034,413 F394Y probably damaging Het
Fbxo24 C A 5: 137,612,811 M572I probably benign Het
Gm13212 A G 4: 145,622,568 T192A probably benign Het
Hnrnpul1 T C 7: 25,748,464 E145G probably benign Het
Ica1 A G 6: 8,658,286 V277A probably benign Het
Idi1 G A 13: 8,887,938 S140N probably benign Het
Kank1 TGCGA T 19: 25,411,204 probably null Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif20b T C 19: 34,939,879 V603A probably damaging Het
Klc2 T C 19: 5,111,839 K276R probably benign Het
Lmbrd2 T A 15: 9,172,230 N370K probably benign Het
Map2k5 G T 9: 63,339,121 A108D probably damaging Het
Obox2 T C 7: 15,397,049 S69P possibly damaging Het
Olfr1364 G A 13: 21,574,478 probably benign Het
Olfr32 A C 2: 90,138,826 F104L probably benign Het
Pcdhga8 A G 18: 37,727,730 E613G probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Rab2a T C 4: 8,604,444 probably null Het
Rsph4a A C 10: 33,909,459 R455S probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem151a T C 19: 5,082,560 E206G probably damaging Het
Tmem156 C T 5: 65,073,861 C222Y probably damaging Het
Tnfrsf11b C T 15: 54,254,202 W219* probably null Het
Ttc36 T C 9: 44,799,601 E144G probably damaging Het
Ttn C T 2: 76,767,457 R19704H probably damaging Het
Wdr17 A C 8: 54,638,368 I1137S possibly damaging Het
Xxylt1 A G 16: 31,007,819 L226P probably damaging Het
Zbtb8b G A 4: 129,428,445 R408W probably damaging Het
Zfp873 T A 10: 82,060,359 V308E probably benign Het
Other mutations in Olfr1308
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Olfr1308 APN 2 111960275 missense possibly damaging 0.84
IGL01359:Olfr1308 APN 2 111961061 missense probably benign
IGL01731:Olfr1308 APN 2 111960635 missense probably benign 0.03
IGL01788:Olfr1308 APN 2 111961007 missense probably benign
IGL02385:Olfr1308 APN 2 111960258 missense probably benign 0.00
IGL02969:Olfr1308 APN 2 111960567 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0244:Olfr1308 UTSW 2 111961016 missense probably benign 0.13
R0265:Olfr1308 UTSW 2 111960494 missense probably damaging 0.99
R1268:Olfr1308 UTSW 2 111960877 missense possibly damaging 0.78
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1568:Olfr1308 UTSW 2 111960240 missense probably benign 0.02
R2401:Olfr1308 UTSW 2 111960149 missense probably benign 0.01
R4396:Olfr1308 UTSW 2 111960215 missense probably damaging 1.00
R4528:Olfr1308 UTSW 2 111960948 missense probably damaging 1.00
R5916:Olfr1308 UTSW 2 111960830 missense probably damaging 1.00
R6332:Olfr1308 UTSW 2 111960746 missense probably damaging 0.98
R6595:Olfr1308 UTSW 2 111960170 missense possibly damaging 0.95
R7339:Olfr1308 UTSW 2 111960611 missense probably benign 0.12
R7917:Olfr1308 UTSW 2 111960965 missense probably damaging 0.98
R8092:Olfr1308 UTSW 2 111960307 missense probably benign 0.00
R8246:Olfr1308 UTSW 2 111960138 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GACAAAGCCTTGGAGGAACC -3'
(R):5'- AGAGGTTGTGTCACTCAAATCTTC -3'

Sequencing Primer
(F):5'- ACCGACATGAATCCACTG -3'
(R):5'- CTTCATTCATTTCATCGGTGGTG -3'
Posted On2020-10-20