Mutagenetix > Incidental Mutation

Incidental Mutation 'R8017:Cfi'

656285

Institutional Source

Beutler Lab

Gene Symbol

Cfi

Ensembl Gene

ENSMUSG00000058952

Gene Name

complement component factor i

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8017 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

129835884-129875332 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129855099 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 211 (S211P)

Ref Sequence

ENSEMBL: ENSMUSP00000077074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077918] [ENSMUST00000200206]

AlphaFold

Q61129

Predicted Effect

probably benign
Transcript: ENSMUST00000077918
AA Change: S211P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: S211P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
FIMAC	45	111	4.63e-38	SMART
KAZAL	63	109	6.91e-3	SMART
SR	117	220	2.95e-22	SMART
LDLa	225	262	1.07e-4	SMART
LDLa	263	300	7.16e-6	SMART
low complexity region	317	326	N/A	INTRINSIC
Tryp_SPc	360	589	3.33e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200206

SMART Domains

Protein: ENSMUSP00000142975
Gene: ENSMUSG00000058952

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
FIMAC	45	111	2.2e-40	SMART
KAZAL	63	109	4.4e-5	SMART
Blast:SR	117	145	3e-11	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

95% (36/38)

MGI Phenotype

FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aar2	T	G	2: 156,555,956	I296S	probably benign	Het
Acsl5	A	G	19: 55,268,796	I42V	probably benign	Het
Adam25	T	A	8: 40,754,087	M130K	possibly damaging	Het
Bcl2l2	T	A	14: 54,884,383	M1K	probably null	Het
Casc1	A	G	6: 145,194,557	S173P	probably damaging	Het
Cdh16	T	C	8: 104,616,267	N724S	probably damaging	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Crybg2	T	A	4: 134,073,173	V239E	possibly damaging	Het
Dcn	G	A	10: 97,483,535	R58Q	probably damaging	Het
Dnah10	A	G	5: 124,800,885	N2678S	probably benign	Het
Fam205a1	T	C	4: 42,850,840	T439A	probably damaging	Het
Fam214b	A	T	4: 43,034,413	F394Y	probably damaging	Het
Fbxo24	C	A	5: 137,612,811	M572I	probably benign	Het
Gm13212	A	G	4: 145,622,568	T192A	probably benign	Het
Hnrnpul1	T	C	7: 25,748,464	E145G	probably benign	Het
Ica1	A	G	6: 8,658,286	V277A	probably benign	Het
Idi1	G	A	13: 8,887,938	S140N	probably benign	Het
Kank1	TGCGA	T	19: 25,411,204		probably null	Het
Kank1	GCGAACG	GCG	19: 25,411,205		probably null	Het
Kif20b	T	C	19: 34,939,879	V603A	probably damaging	Het
Klc2	T	C	19: 5,111,839	K276R	probably benign	Het
Lmbrd2	T	A	15: 9,172,230	N370K	probably benign	Het
Map2k5	G	T	9: 63,339,121	A108D	probably damaging	Het
Obox2	T	C	7: 15,397,049	S69P	possibly damaging	Het
Olfr1308	G	A	2: 111,960,573	P167S	probably damaging	Het
Olfr1364	G	A	13: 21,574,478		probably benign	Het
Olfr32	A	C	2: 90,138,826	F104L	probably benign	Het
Pcdhga8	A	G	18: 37,727,730	E613G	probably damaging	Het
Pira2	A	T	7: 3,841,697	F445Y	probably benign	Het
Rab2a	T	C	4: 8,604,444		probably null	Het
Rsph4a	A	C	10: 33,909,459	R455S	probably damaging	Het
St6gal1	G	A	16: 23,357,835	A393T	probably benign	Het
Tmem151a	T	C	19: 5,082,560	E206G	probably damaging	Het
Tmem156	C	T	5: 65,073,861	C222Y	probably damaging	Het
Tnfrsf11b	C	T	15: 54,254,202	W219*	probably null	Het
Ttc36	T	C	9: 44,799,601	E144G	probably damaging	Het
Ttn	C	T	2: 76,767,457	R19704H	probably damaging	Het
Wdr17	A	C	8: 54,638,368	I1137S	possibly damaging	Het
Xxylt1	A	G	16: 31,007,819	L226P	probably damaging	Het
Zbtb8b	G	A	4: 129,428,445	R408W	probably damaging	Het
Zfp873	T	A	10: 82,060,359	V308E	probably benign	Het

Other mutations in Cfi

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Cfi	APN	3	129873095	missense	probably damaging	0.97
IGL00659:Cfi	APN	3	129836813	missense	unknown
IGL01310:Cfi	APN	3	129858431	missense	probably damaging	1.00
IGL01387:Cfi	APN	3	129874913	unclassified	probably benign
IGL01897:Cfi	APN	3	129858385	missense	probably damaging	1.00
IGL02418:Cfi	APN	3	129848812	missense	probably benign	0.20
F5770:Cfi	UTSW	3	129854992	missense	possibly damaging	0.62
R0085:Cfi	UTSW	3	129874986	missense	probably benign	0.00
R0102:Cfi	UTSW	3	129848767	missense	probably damaging	0.97
R0102:Cfi	UTSW	3	129848767	missense	probably damaging	0.97
R0835:Cfi	UTSW	3	129868542	missense	probably damaging	1.00
R1191:Cfi	UTSW	3	129868527	missense	probably benign	0.01
R1221:Cfi	UTSW	3	129872969	missense	probably damaging	0.99
R1576:Cfi	UTSW	3	129873050	missense	probably damaging	0.98
R1809:Cfi	UTSW	3	129873119	critical splice donor site	probably null
R1940:Cfi	UTSW	3	129858828	splice site	probably benign
R1983:Cfi	UTSW	3	129868545	missense	probably damaging	1.00
R2069:Cfi	UTSW	3	129858804	splice site	probably null
R3012:Cfi	UTSW	3	129874930	missense	probably damaging	1.00
R4334:Cfi	UTSW	3	129850829	missense	possibly damaging	0.80
R4596:Cfi	UTSW	3	129868500	missense	probably damaging	0.98
R4888:Cfi	UTSW	3	129873077	missense	probably damaging	1.00
R5121:Cfi	UTSW	3	129873077	missense	probably damaging	1.00
R5322:Cfi	UTSW	3	129873040	missense	probably damaging	1.00
R5673:Cfi	UTSW	3	129855009	missense	probably benign	0.02
R6084:Cfi	UTSW	3	129858370	missense	probably benign	0.00
R6364:Cfi	UTSW	3	129872846	missense	probably benign	0.36
R6770:Cfi	UTSW	3	129858730	missense	probably benign	0.21
R7000:Cfi	UTSW	3	129872873	missense	probably damaging	1.00
R7108:Cfi	UTSW	3	129875016	missense	probably damaging	1.00
R7194:Cfi	UTSW	3	129855059	missense	probably damaging	1.00
R7342:Cfi	UTSW	3	129875132	missense	probably damaging	1.00
R7470:Cfi	UTSW	3	129855087	missense	probably benign	0.01
R7538:Cfi	UTSW	3	129858815	missense	probably benign	0.08
R7908:Cfi	UTSW	3	129848584	missense	probably benign	0.01
R7954:Cfi	UTSW	3	129868585	critical splice donor site	probably null
R8135:Cfi	UTSW	3	129855000	missense	probably benign	0.00
R8155:Cfi	UTSW	3	129855090	missense	probably benign	0.00
R8217:Cfi	UTSW	3	129855001	missense	possibly damaging	0.61
R8530:Cfi	UTSW	3	129850733	missense	possibly damaging	0.79
R8767:Cfi	UTSW	3	129850848	critical splice donor site	probably null
R9578:Cfi	UTSW	3	129865375	missense	probably benign
R9590:Cfi	UTSW	3	129848812	missense	probably benign	0.02
R9774:Cfi	UTSW	3	129874996	missense	probably damaging	0.99
V7580:Cfi	UTSW	3	129854992	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CACAGAGTTTATTCTTCCACCAG -3'
(R):5'- AAACCTGGACGGCAGGTTTC -3'

Sequencing Primer
(F):5'- AGTTTTCACTCATTCTGTTTGCAGG -3'
(R):5'- GGAGGGTCCCAAATACCAGTTC -3'

Posted On

2020-10-20