Incidental Mutation 'R8017:Cfi'
ID656285
Institutional Source Beutler Lab
Gene Symbol Cfi
Ensembl Gene ENSMUSG00000058952
Gene Namecomplement component factor i
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8017 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location129835884-129875332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129855099 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 211 (S211P)
Ref Sequence ENSEMBL: ENSMUSP00000077074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077918] [ENSMUST00000200206]
Predicted Effect probably benign
Transcript: ENSMUST00000077918
AA Change: S211P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: S211P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 4.63e-38 SMART
KAZAL 63 109 6.91e-3 SMART
SR 117 220 2.95e-22 SMART
LDLa 225 262 1.07e-4 SMART
LDLa 263 300 7.16e-6 SMART
low complexity region 317 326 N/A INTRINSIC
Tryp_SPc 360 589 3.33e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200206
SMART Domains Protein: ENSMUSP00000142975
Gene: ENSMUSG00000058952

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 2.2e-40 SMART
KAZAL 63 109 4.4e-5 SMART
Blast:SR 117 145 3e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,555,956 I296S probably benign Het
Acsl5 A G 19: 55,268,796 I42V probably benign Het
Adam25 T A 8: 40,754,087 M130K possibly damaging Het
Bcl2l2 T A 14: 54,884,383 M1K probably null Het
Casc1 A G 6: 145,194,557 S173P probably damaging Het
Cdh16 T C 8: 104,616,267 N724S probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Crybg2 T A 4: 134,073,173 V239E possibly damaging Het
Dcn G A 10: 97,483,535 R58Q probably damaging Het
Dnah10 A G 5: 124,800,885 N2678S probably benign Het
Fam205a1 T C 4: 42,850,840 T439A probably damaging Het
Fam214b A T 4: 43,034,413 F394Y probably damaging Het
Fbxo24 C A 5: 137,612,811 M572I probably benign Het
Gm13212 A G 4: 145,622,568 T192A probably benign Het
Hnrnpul1 T C 7: 25,748,464 E145G probably benign Het
Ica1 A G 6: 8,658,286 V277A probably benign Het
Idi1 G A 13: 8,887,938 S140N probably benign Het
Kank1 TGCGA T 19: 25,411,204 probably null Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif20b T C 19: 34,939,879 V603A probably damaging Het
Klc2 T C 19: 5,111,839 K276R probably benign Het
Lmbrd2 T A 15: 9,172,230 N370K probably benign Het
Map2k5 G T 9: 63,339,121 A108D probably damaging Het
Obox2 T C 7: 15,397,049 S69P possibly damaging Het
Olfr1308 G A 2: 111,960,573 P167S probably damaging Het
Olfr1364 G A 13: 21,574,478 probably benign Het
Olfr32 A C 2: 90,138,826 F104L probably benign Het
Pcdhga8 A G 18: 37,727,730 E613G probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Rab2a T C 4: 8,604,444 probably null Het
Rsph4a A C 10: 33,909,459 R455S probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem151a T C 19: 5,082,560 E206G probably damaging Het
Tmem156 C T 5: 65,073,861 C222Y probably damaging Het
Tnfrsf11b C T 15: 54,254,202 W219* probably null Het
Ttc36 T C 9: 44,799,601 E144G probably damaging Het
Ttn C T 2: 76,767,457 R19704H probably damaging Het
Wdr17 A C 8: 54,638,368 I1137S possibly damaging Het
Xxylt1 A G 16: 31,007,819 L226P probably damaging Het
Zbtb8b G A 4: 129,428,445 R408W probably damaging Het
Zfp873 T A 10: 82,060,359 V308E probably benign Het
Other mutations in Cfi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cfi APN 3 129873095 missense probably damaging 0.97
IGL00659:Cfi APN 3 129836813 missense unknown
IGL01310:Cfi APN 3 129858431 missense probably damaging 1.00
IGL01387:Cfi APN 3 129874913 unclassified probably benign
IGL01897:Cfi APN 3 129858385 missense probably damaging 1.00
IGL02418:Cfi APN 3 129848812 missense probably benign 0.20
F5770:Cfi UTSW 3 129854992 missense possibly damaging 0.62
R0085:Cfi UTSW 3 129874986 missense probably benign 0.00
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0835:Cfi UTSW 3 129868542 missense probably damaging 1.00
R1191:Cfi UTSW 3 129868527 missense probably benign 0.01
R1221:Cfi UTSW 3 129872969 missense probably damaging 0.99
R1576:Cfi UTSW 3 129873050 missense probably damaging 0.98
R1809:Cfi UTSW 3 129873119 critical splice donor site probably null
R1940:Cfi UTSW 3 129858828 splice site probably benign
R1983:Cfi UTSW 3 129868545 missense probably damaging 1.00
R2069:Cfi UTSW 3 129858804 splice site probably null
R3012:Cfi UTSW 3 129874930 missense probably damaging 1.00
R4334:Cfi UTSW 3 129850829 missense possibly damaging 0.80
R4596:Cfi UTSW 3 129868500 missense probably damaging 0.98
R4888:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5121:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5322:Cfi UTSW 3 129873040 missense probably damaging 1.00
R5673:Cfi UTSW 3 129855009 missense probably benign 0.02
R6084:Cfi UTSW 3 129858370 missense probably benign 0.00
R6364:Cfi UTSW 3 129872846 missense probably benign 0.36
R6770:Cfi UTSW 3 129858730 missense probably benign 0.21
R7000:Cfi UTSW 3 129872873 missense probably damaging 1.00
R7108:Cfi UTSW 3 129875016 missense probably damaging 1.00
R7194:Cfi UTSW 3 129855059 missense probably damaging 1.00
R7342:Cfi UTSW 3 129875132 missense probably damaging 1.00
R7470:Cfi UTSW 3 129855087 missense probably benign 0.01
R7538:Cfi UTSW 3 129858815 missense probably benign 0.08
R7908:Cfi UTSW 3 129848584 missense probably benign 0.01
R7954:Cfi UTSW 3 129868585 critical splice donor site probably null
R8135:Cfi UTSW 3 129855000 missense probably benign 0.00
R8155:Cfi UTSW 3 129855090 missense probably benign 0.00
R8217:Cfi UTSW 3 129855001 missense possibly damaging 0.61
R8530:Cfi UTSW 3 129850733 missense possibly damaging 0.79
R8767:Cfi UTSW 3 129850848 critical splice donor site probably null
V7580:Cfi UTSW 3 129854992 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CACAGAGTTTATTCTTCCACCAG -3'
(R):5'- AAACCTGGACGGCAGGTTTC -3'

Sequencing Primer
(F):5'- AGTTTTCACTCATTCTGTTTGCAGG -3'
(R):5'- GGAGGGTCCCAAATACCAGTTC -3'
Posted On2020-10-20