Incidental Mutation 'R8017:Tmem156'
ID656292
Institutional Source Beutler Lab
Gene Symbol Tmem156
Ensembl Gene ENSMUSG00000037913
Gene Nametransmembrane protein 156
SynonymsLOC243025
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R8017 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location65054346-65092132 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65073861 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 222 (C222Y)
Ref Sequence ENSEMBL: ENSMUSP00000148480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043352] [ENSMUST00000212080] [ENSMUST00000212194] [ENSMUST00000212640]
Predicted Effect probably damaging
Transcript: ENSMUST00000043352
AA Change: C210Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044102
Gene: ENSMUSG00000037913
AA Change: C210Y

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:TMEM156 39 264 1.2e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212080
AA Change: C222Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212194
AA Change: C187Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212640
AA Change: C158Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,555,956 I296S probably benign Het
Acsl5 A G 19: 55,268,796 I42V probably benign Het
Adam25 T A 8: 40,754,087 M130K possibly damaging Het
Bcl2l2 T A 14: 54,884,383 M1K probably null Het
Casc1 A G 6: 145,194,557 S173P probably damaging Het
Cdh16 T C 8: 104,616,267 N724S probably damaging Het
Cfi T C 3: 129,855,099 S211P probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Crybg2 T A 4: 134,073,173 V239E possibly damaging Het
Dcn G A 10: 97,483,535 R58Q probably damaging Het
Dnah10 A G 5: 124,800,885 N2678S probably benign Het
Fam205a1 T C 4: 42,850,840 T439A probably damaging Het
Fam214b A T 4: 43,034,413 F394Y probably damaging Het
Fbxo24 C A 5: 137,612,811 M572I probably benign Het
Gm13212 A G 4: 145,622,568 T192A probably benign Het
Hnrnpul1 T C 7: 25,748,464 E145G probably benign Het
Ica1 A G 6: 8,658,286 V277A probably benign Het
Idi1 G A 13: 8,887,938 S140N probably benign Het
Kank1 TGCGA T 19: 25,411,204 probably null Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif20b T C 19: 34,939,879 V603A probably damaging Het
Klc2 T C 19: 5,111,839 K276R probably benign Het
Lmbrd2 T A 15: 9,172,230 N370K probably benign Het
Map2k5 G T 9: 63,339,121 A108D probably damaging Het
Obox2 T C 7: 15,397,049 S69P possibly damaging Het
Olfr1308 G A 2: 111,960,573 P167S probably damaging Het
Olfr1364 G A 13: 21,574,478 probably benign Het
Olfr32 A C 2: 90,138,826 F104L probably benign Het
Pcdhga8 A G 18: 37,727,730 E613G probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Rab2a T C 4: 8,604,444 probably null Het
Rsph4a A C 10: 33,909,459 R455S probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem151a T C 19: 5,082,560 E206G probably damaging Het
Tnfrsf11b C T 15: 54,254,202 W219* probably null Het
Ttc36 T C 9: 44,799,601 E144G probably damaging Het
Ttn C T 2: 76,767,457 R19704H probably damaging Het
Wdr17 A C 8: 54,638,368 I1137S possibly damaging Het
Xxylt1 A G 16: 31,007,819 L226P probably damaging Het
Zbtb8b G A 4: 129,428,445 R408W probably damaging Het
Zfp873 T A 10: 82,060,359 V308E probably benign Het
Other mutations in Tmem156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Tmem156 APN 5 65073840 missense probably damaging 1.00
IGL01064:Tmem156 APN 5 65079984 missense probably damaging 0.99
IGL01330:Tmem156 APN 5 65080182 missense probably benign 0.17
IGL03336:Tmem156 APN 5 65075764 missense probably benign 0.01
IGL03383:Tmem156 APN 5 65075697 missense probably damaging 0.98
R0526:Tmem156 UTSW 5 65075818 missense probably benign 0.02
R2006:Tmem156 UTSW 5 65079951 missense probably damaging 1.00
R4721:Tmem156 UTSW 5 65091527 missense probably benign 0.10
R4773:Tmem156 UTSW 5 65080159 missense probably damaging 1.00
R4810:Tmem156 UTSW 5 65091447 intron probably benign
R4910:Tmem156 UTSW 5 65091462 intron probably benign
R5148:Tmem156 UTSW 5 65073768 missense probably benign 0.00
R5510:Tmem156 UTSW 5 65075574 missense probably benign 0.02
R5809:Tmem156 UTSW 5 65075607 missense possibly damaging 0.55
R6033:Tmem156 UTSW 5 65075621 missense probably benign 0.35
R6033:Tmem156 UTSW 5 65075621 missense probably benign 0.35
R7731:Tmem156 UTSW 5 65075562 critical splice donor site probably null
R7772:Tmem156 UTSW 5 65080174 missense probably damaging 1.00
R7788:Tmem156 UTSW 5 65075569 missense possibly damaging 0.47
R7979:Tmem156 UTSW 5 65080009 missense possibly damaging 0.47
R8132:Tmem156 UTSW 5 65075755 missense probably benign 0.00
R8249:Tmem156 UTSW 5 65075626 nonsense probably null
RF020:Tmem156 UTSW 5 65091547 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GGGGCAAACAGGTATTTGTATG -3'
(R):5'- TTAAGGCTGCAAACGCCTTC -3'

Sequencing Primer
(F):5'- GCAAACAGGTATTTGTATGTGTTTTC -3'
(R):5'- TGTCTGCCATAGCACACGAGTAG -3'
Posted On2020-10-20