Incidental Mutation 'R8017:Map2k5'
ID656304
Institutional Source Beutler Lab
Gene Symbol Map2k5
Ensembl Gene ENSMUSG00000058444
Gene Namemitogen-activated protein kinase kinase 5
SynonymsMEK5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8017 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location63163768-63377902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63339121 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 108 (A108D)
Ref Sequence ENSEMBL: ENSMUSP00000034920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034920]
PDB Structure Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000034920
AA Change: A108D

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444
AA Change: A108D

DomainStartEndE-ValueType
PB1 18 97 7.59e-12 SMART
S_TKc 166 419 7.75e-71 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,555,956 I296S probably benign Het
Acsl5 A G 19: 55,268,796 I42V probably benign Het
Adam25 T A 8: 40,754,087 M130K possibly damaging Het
Bcl2l2 T A 14: 54,884,383 M1K probably null Het
Casc1 A G 6: 145,194,557 S173P probably damaging Het
Cdh16 T C 8: 104,616,267 N724S probably damaging Het
Cfi T C 3: 129,855,099 S211P probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Crybg2 T A 4: 134,073,173 V239E possibly damaging Het
Dcn G A 10: 97,483,535 R58Q probably damaging Het
Dnah10 A G 5: 124,800,885 N2678S probably benign Het
Fam205a1 T C 4: 42,850,840 T439A probably damaging Het
Fam214b A T 4: 43,034,413 F394Y probably damaging Het
Fbxo24 C A 5: 137,612,811 M572I probably benign Het
Gm13212 A G 4: 145,622,568 T192A probably benign Het
Hnrnpul1 T C 7: 25,748,464 E145G probably benign Het
Ica1 A G 6: 8,658,286 V277A probably benign Het
Idi1 G A 13: 8,887,938 S140N probably benign Het
Kank1 TGCGA T 19: 25,411,204 probably null Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif20b T C 19: 34,939,879 V603A probably damaging Het
Klc2 T C 19: 5,111,839 K276R probably benign Het
Lmbrd2 T A 15: 9,172,230 N370K probably benign Het
Obox2 T C 7: 15,397,049 S69P possibly damaging Het
Olfr1308 G A 2: 111,960,573 P167S probably damaging Het
Olfr1364 G A 13: 21,574,478 probably benign Het
Olfr32 A C 2: 90,138,826 F104L probably benign Het
Pcdhga8 A G 18: 37,727,730 E613G probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Rab2a T C 4: 8,604,444 probably null Het
Rsph4a A C 10: 33,909,459 R455S probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem151a T C 19: 5,082,560 E206G probably damaging Het
Tmem156 C T 5: 65,073,861 C222Y probably damaging Het
Tnfrsf11b C T 15: 54,254,202 W219* probably null Het
Ttc36 T C 9: 44,799,601 E144G probably damaging Het
Ttn C T 2: 76,767,457 R19704H probably damaging Het
Wdr17 A C 8: 54,638,368 I1137S possibly damaging Het
Xxylt1 A G 16: 31,007,819 L226P probably damaging Het
Zbtb8b G A 4: 129,428,445 R408W probably damaging Het
Zfp873 T A 10: 82,060,359 V308E probably benign Het
Other mutations in Map2k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Map2k5 APN 9 63281077 splice site probably benign
IGL01412:Map2k5 APN 9 63293706 missense probably damaging 1.00
IGL01766:Map2k5 APN 9 63377227 missense probably benign
IGL02246:Map2k5 APN 9 63377129 missense probably benign 0.10
IGL02270:Map2k5 APN 9 63322197 splice site probably null
IGL02793:Map2k5 APN 9 63257039 missense probably benign 0.32
IGL03236:Map2k5 APN 9 63286392 splice site probably benign
R0007:Map2k5 UTSW 9 63293724 missense probably damaging 1.00
R0217:Map2k5 UTSW 9 63256975 critical splice donor site probably null
R0315:Map2k5 UTSW 9 63303151 missense probably damaging 1.00
R0801:Map2k5 UTSW 9 63357979 splice site probably benign
R1122:Map2k5 UTSW 9 63263163 missense probably damaging 1.00
R1822:Map2k5 UTSW 9 63235303 missense possibly damaging 0.79
R4308:Map2k5 UTSW 9 63235304 missense probably benign 0.02
R4421:Map2k5 UTSW 9 63164130 missense probably damaging 0.96
R4720:Map2k5 UTSW 9 63293719 missense probably damaging 1.00
R4869:Map2k5 UTSW 9 63322243 nonsense probably null
R5059:Map2k5 UTSW 9 63257014 missense probably benign 0.41
R5138:Map2k5 UTSW 9 63263158 missense probably damaging 0.99
R6005:Map2k5 UTSW 9 63281019 missense probably damaging 1.00
R6258:Map2k5 UTSW 9 63217365 missense probably benign 0.16
R6261:Map2k5 UTSW 9 63338098 missense probably benign 0.00
R6498:Map2k5 UTSW 9 63286401 missense possibly damaging 0.74
R6808:Map2k5 UTSW 9 63322246 missense probably benign 0.00
R7228:Map2k5 UTSW 9 63358022 missense probably damaging 1.00
R7819:Map2k5 UTSW 9 63358018 missense probably damaging 0.99
R8053:Map2k5 UTSW 9 63343425 missense probably benign 0.16
R8247:Map2k5 UTSW 9 63371737 missense probably damaging 1.00
R8309:Map2k5 UTSW 9 63339079 critical splice donor site probably null
R8341:Map2k5 UTSW 9 63339098 missense probably damaging 1.00
Z1176:Map2k5 UTSW 9 63358038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCACCACTCGAAAATGGGG -3'
(R):5'- TGAAGTGGTGTCAGAAAGCTC -3'

Sequencing Primer
(F):5'- GGGCGGGGGAAGAGGAG -3'
(R):5'- GCTCTGTGCATTTATAAACACTCAC -3'
Posted On2020-10-20