Incidental Mutation 'R8017:Tnfrsf11b'
ID 656312
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11b
Ensembl Gene ENSMUSG00000063727
Gene Name tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)
Synonyms Opg, OCIF, OPG, TR1, osteoclastogenesis inhibitory factor
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_008764.3; MGI:109587
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R8017 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 54250619-54278484 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 54254202 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 219 (W219*)
Ref Sequence ENSEMBL: ENSMUSP00000078705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079772]
AlphaFold O08712
PDB Structure Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000079772
AA Change: W219*
SMART Domains Protein: ENSMUSP00000078705
Gene: ENSMUSG00000063727
AA Change: W219*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 24 62 1.04e-2 SMART
TNFR 65 105 1.5e-8 SMART
TNFR 107 142 2.19e-10 SMART
TNFR 145 185 7.63e-1 SMART
DEATH 270 365 1.01e-9 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 95% (36/38)
MGI Phenotype Strain: 2181227
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have abnormal bone remodeling that results in severe osteoperosis with increased risk of fractures and growth retardation. Progressive hearing loss also results due to abnormal remodeling of the otic capsule. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,555,956 I296S probably benign Het
Acsl5 A G 19: 55,268,796 I42V probably benign Het
Adam25 T A 8: 40,754,087 M130K possibly damaging Het
Bcl2l2 T A 14: 54,884,383 M1K probably null Het
Casc1 A G 6: 145,194,557 S173P probably damaging Het
Cdh16 T C 8: 104,616,267 N724S probably damaging Het
Cfi T C 3: 129,855,099 S211P probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Crybg2 T A 4: 134,073,173 V239E possibly damaging Het
Dcn G A 10: 97,483,535 R58Q probably damaging Het
Dnah10 A G 5: 124,800,885 N2678S probably benign Het
Fam205a1 T C 4: 42,850,840 T439A probably damaging Het
Fam214b A T 4: 43,034,413 F394Y probably damaging Het
Fbxo24 C A 5: 137,612,811 M572I probably benign Het
Gm13212 A G 4: 145,622,568 T192A probably benign Het
Hnrnpul1 T C 7: 25,748,464 E145G probably benign Het
Ica1 A G 6: 8,658,286 V277A probably benign Het
Idi1 G A 13: 8,887,938 S140N probably benign Het
Kank1 TGCGA T 19: 25,411,204 probably null Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif20b T C 19: 34,939,879 V603A probably damaging Het
Klc2 T C 19: 5,111,839 K276R probably benign Het
Lmbrd2 T A 15: 9,172,230 N370K probably benign Het
Map2k5 G T 9: 63,339,121 A108D probably damaging Het
Obox2 T C 7: 15,397,049 S69P possibly damaging Het
Olfr1308 G A 2: 111,960,573 P167S probably damaging Het
Olfr1364 G A 13: 21,574,478 probably benign Het
Olfr32 A C 2: 90,138,826 F104L probably benign Het
Pcdhga8 A G 18: 37,727,730 E613G probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Rab2a T C 4: 8,604,444 probably null Het
Rsph4a A C 10: 33,909,459 R455S probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem151a T C 19: 5,082,560 E206G probably damaging Het
Tmem156 C T 5: 65,073,861 C222Y probably damaging Het
Ttc36 T C 9: 44,799,601 E144G probably damaging Het
Ttn C T 2: 76,767,457 R19704H probably damaging Het
Wdr17 A C 8: 54,638,368 I1137S possibly damaging Het
Xxylt1 A G 16: 31,007,819 L226P probably damaging Het
Zbtb8b G A 4: 129,428,445 R408W probably damaging Het
Zfp873 T A 10: 82,060,359 V308E probably benign Het
Other mutations in Tnfrsf11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnfrsf11b APN 15 54259842 missense probably damaging 1.00
IGL00770:Tnfrsf11b APN 15 54254072 missense probably benign 0.16
IGL00774:Tnfrsf11b APN 15 54254072 missense probably benign 0.16
IGL02355:Tnfrsf11b APN 15 54252382 missense probably damaging 0.96
IGL02362:Tnfrsf11b APN 15 54252382 missense probably damaging 0.96
IGL02711:Tnfrsf11b APN 15 54256136 missense probably benign 0.01
IGL02870:Tnfrsf11b APN 15 54256027 missense probably benign 0.05
IGL03219:Tnfrsf11b APN 15 54254178 nonsense probably null
P0012:Tnfrsf11b UTSW 15 54259798 splice site probably benign
R1550:Tnfrsf11b UTSW 15 54254058 missense possibly damaging 0.94
R1813:Tnfrsf11b UTSW 15 54256097 nonsense probably null
R3840:Tnfrsf11b UTSW 15 54252082 missense probably damaging 0.99
R3910:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R3911:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R3912:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R4299:Tnfrsf11b UTSW 15 54252095 missense probably benign
R4362:Tnfrsf11b UTSW 15 54256159 missense possibly damaging 0.94
R4363:Tnfrsf11b UTSW 15 54256159 missense possibly damaging 0.94
R5288:Tnfrsf11b UTSW 15 54278226 missense probably benign 0.00
R5653:Tnfrsf11b UTSW 15 54259866 missense probably damaging 1.00
R5753:Tnfrsf11b UTSW 15 54254059 missense possibly damaging 0.90
R6881:Tnfrsf11b UTSW 15 54254143 missense probably benign 0.00
R6997:Tnfrsf11b UTSW 15 54252374 missense probably damaging 0.99
R7704:Tnfrsf11b UTSW 15 54260101 missense probably benign 0.30
R7730:Tnfrsf11b UTSW 15 54254074 nonsense probably null
R8052:Tnfrsf11b UTSW 15 54252106 missense probably damaging 1.00
R8060:Tnfrsf11b UTSW 15 54254109 missense probably benign 0.38
R8711:Tnfrsf11b UTSW 15 54260112 missense possibly damaging 0.81
R9224:Tnfrsf11b UTSW 15 54252160 missense possibly damaging 0.67
X0025:Tnfrsf11b UTSW 15 54278235 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GGCAACTTGGTTCCTTTGATC -3'
(R):5'- GTGTCTCGCAGAAAACTCAAC -3'

Sequencing Primer
(F):5'- CCATTGACTTGTTTATTTCAGGAGC -3'
(R):5'- AACCCCCATACTCATTTTGTGG -3'
Posted On 2020-10-20