Mutagenetix > Incidental Mutation

Incidental Mutation 'R8017:Kank1'

656319

Institutional Source

Beutler Lab

Gene Symbol

Kank1

Ensembl Gene

ENSMUSG00000032702

Gene Name

KN motif and ankyrin repeat domains 1

Synonyms

D330024H06Rik, Ankrd15, A930031B09Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8017 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

25236975-25434496 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

TGCGA to T at 25411204 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000116660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]

AlphaFold

E9Q238

Predicted Effect

probably null
Transcript: ENSMUST00000049400

SMART Domains

Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702

Domain	Start	End	E-Value	Type
Pfam:KN_motif	30	68	3.3e-24	PFAM
low complexity region	88	105	N/A	INTRINSIC
low complexity region	138	148	N/A	INTRINSIC
coiled coil region	286	314	N/A	INTRINSIC
low complexity region	350	358	N/A	INTRINSIC
coiled coil region	362	395	N/A	INTRINSIC
coiled coil region	451	494	N/A	INTRINSIC
low complexity region	541	556	N/A	INTRINSIC
low complexity region	617	629	N/A	INTRINSIC
Blast:ANK	963	993	7e-10	BLAST
low complexity region	1010	1030	N/A	INTRINSIC
low complexity region	1074	1095	N/A	INTRINSIC
ANK	1169	1199	3.71e-4	SMART
ANK	1203	1236	2.27e1	SMART
ANK	1241	1270	1.33e-5	SMART
ANK	1274	1306	5.84e-2	SMART
ANK	1308	1336	4.86e1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000146647

SMART Domains

Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702

Domain	Start	End	E-Value	Type
Pfam:KN_motif	58	96	2e-25	PFAM
low complexity region	116	133	N/A	INTRINSIC
low complexity region	166	176	N/A	INTRINSIC
coiled coil region	314	342	N/A	INTRINSIC
low complexity region	378	386	N/A	INTRINSIC
coiled coil region	390	423	N/A	INTRINSIC
internal_repeat_1	430	479	3.72e-5	PROSPERO
low complexity region	569	584	N/A	INTRINSIC
internal_repeat_1	587	636	3.72e-5	PROSPERO
low complexity region	645	657	N/A	INTRINSIC
Blast:ANK	991	1021	4e-10	BLAST
low complexity region	1038	1058	N/A	INTRINSIC
low complexity region	1102	1123	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

95% (36/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aar2	T	G	2: 156,555,956	I296S	probably benign	Het
Acsl5	A	G	19: 55,268,796	I42V	probably benign	Het
Adam25	T	A	8: 40,754,087	M130K	possibly damaging	Het
Bcl2l2	T	A	14: 54,884,383	M1K	probably null	Het
Casc1	A	G	6: 145,194,557	S173P	probably damaging	Het
Cdh16	T	C	8: 104,616,267	N724S	probably damaging	Het
Cfi	T	C	3: 129,855,099	S211P	probably benign	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Crybg2	T	A	4: 134,073,173	V239E	possibly damaging	Het
Dcn	G	A	10: 97,483,535	R58Q	probably damaging	Het
Dnah10	A	G	5: 124,800,885	N2678S	probably benign	Het
Fam205a1	T	C	4: 42,850,840	T439A	probably damaging	Het
Fam214b	A	T	4: 43,034,413	F394Y	probably damaging	Het
Fbxo24	C	A	5: 137,612,811	M572I	probably benign	Het
Gm13212	A	G	4: 145,622,568	T192A	probably benign	Het
Hnrnpul1	T	C	7: 25,748,464	E145G	probably benign	Het
Ica1	A	G	6: 8,658,286	V277A	probably benign	Het
Idi1	G	A	13: 8,887,938	S140N	probably benign	Het
Kif20b	T	C	19: 34,939,879	V603A	probably damaging	Het
Klc2	T	C	19: 5,111,839	K276R	probably benign	Het
Lmbrd2	T	A	15: 9,172,230	N370K	probably benign	Het
Map2k5	G	T	9: 63,339,121	A108D	probably damaging	Het
Obox2	T	C	7: 15,397,049	S69P	possibly damaging	Het
Olfr1308	G	A	2: 111,960,573	P167S	probably damaging	Het
Olfr1364	G	A	13: 21,574,478		probably benign	Het
Olfr32	A	C	2: 90,138,826	F104L	probably benign	Het
Pcdhga8	A	G	18: 37,727,730	E613G	probably damaging	Het
Pira2	A	T	7: 3,841,697	F445Y	probably benign	Het
Rab2a	T	C	4: 8,604,444		probably null	Het
Rsph4a	A	C	10: 33,909,459	R455S	probably damaging	Het
St6gal1	G	A	16: 23,357,835	A393T	probably benign	Het
Tmem151a	T	C	19: 5,082,560	E206G	probably damaging	Het
Tmem156	C	T	5: 65,073,861	C222Y	probably damaging	Het
Tnfrsf11b	C	T	15: 54,254,202	W219*	probably null	Het
Ttc36	T	C	9: 44,799,601	E144G	probably damaging	Het
Ttn	C	T	2: 76,767,457	R19704H	probably damaging	Het
Wdr17	A	C	8: 54,638,368	I1137S	possibly damaging	Het
Xxylt1	A	G	16: 31,007,819	L226P	probably damaging	Het
Zbtb8b	G	A	4: 129,428,445	R408W	probably damaging	Het
Zfp873	T	A	10: 82,060,359	V308E	probably benign	Het

Other mutations in Kank1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Kank1	APN	19	25411758	missense	probably benign
IGL00435:Kank1	APN	19	25430236	missense	probably benign	0.41
IGL01105:Kank1	APN	19	25424316	missense	possibly damaging	0.80
IGL01974:Kank1	APN	19	25410232	missense	possibly damaging	0.87
IGL02031:Kank1	APN	19	25410702	missense	probably benign	0.01
IGL02125:Kank1	APN	19	25410703	missense	possibly damaging	0.90
IGL02152:Kank1	APN	19	25428172	missense	possibly damaging	0.51
IGL02211:Kank1	APN	19	25430338	missense	probably damaging	1.00
IGL02440:Kank1	APN	19	25432908	missense	probably damaging	1.00
IGL02448:Kank1	APN	19	25411375	missense	probably damaging	1.00
IGL02671:Kank1	APN	19	25428095	missense	probably damaging	1.00
IGL03102:Kank1	APN	19	25425918	missense	probably damaging	1.00
IGL03259:Kank1	APN	19	25430341	missense	probably damaging	1.00
IGL02802:Kank1	UTSW	19	25411599	missense	probably damaging	1.00
R0107:Kank1	UTSW	19	25430366	unclassified	probably benign
R0190:Kank1	UTSW	19	25409283	missense	probably benign	0.00
R0330:Kank1	UTSW	19	25424313	missense	probably benign	0.00
R0368:Kank1	UTSW	19	25410603	nonsense	probably null
R0399:Kank1	UTSW	19	25411242	missense	probably benign	0.00
R0426:Kank1	UTSW	19	25411473	missense	probably damaging	1.00
R0483:Kank1	UTSW	19	25425993	unclassified	probably benign
R1394:Kank1	UTSW	19	25428164	missense	probably damaging	1.00
R1495:Kank1	UTSW	19	25410349	missense	probably damaging	0.98
R1681:Kank1	UTSW	19	25410304	missense	possibly damaging	0.89
R1698:Kank1	UTSW	19	25411317	missense	probably benign	0.11
R1830:Kank1	UTSW	19	25411032	missense	probably benign	0.00
R1866:Kank1	UTSW	19	25411449	missense	probably benign	0.04
R2138:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2139:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2420:Kank1	UTSW	19	25410457	missense	probably damaging	1.00
R3153:Kank1	UTSW	19	25410688	missense	possibly damaging	0.89
R4164:Kank1	UTSW	19	25411072	missense	probably benign	0.10
R4670:Kank1	UTSW	19	25410580	missense	probably benign	0.00
R4685:Kank1	UTSW	19	25410034	missense	possibly damaging	0.66
R4843:Kank1	UTSW	19	25431007	missense	probably damaging	1.00
R4981:Kank1	UTSW	19	25411395	missense	probably benign	0.19
R5189:Kank1	UTSW	19	25424181	missense	probably damaging	1.00
R5280:Kank1	UTSW	19	25411305	missense	probably benign	0.01
R5330:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5331:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5435:Kank1	UTSW	19	25411143	missense	probably benign	0.04
R5500:Kank1	UTSW	19	25424332	missense	possibly damaging	0.46
R5894:Kank1	UTSW	19	25424200	missense	probably damaging	1.00
R6087:Kank1	UTSW	19	25409724	missense	probably benign	0.41
R6357:Kank1	UTSW	19	25411353	missense	probably benign	0.36
R6490:Kank1	UTSW	19	25410085	missense	probably damaging	1.00
R6504:Kank1	UTSW	19	25428154	missense	probably damaging	1.00
R6942:Kank1	UTSW	19	25424173	missense	possibly damaging	0.88
R7037:Kank1	UTSW	19	25430341	missense	probably damaging	1.00
R7405:Kank1	UTSW	19	25410319	nonsense	probably null
R7486:Kank1	UTSW	19	25410829	missense	probably damaging	0.99
R7602:Kank1	UTSW	19	25422161	missense	probably benign	0.01
R7701:Kank1	UTSW	19	25411765	critical splice donor site	probably null
R7765:Kank1	UTSW	19	25411205	frame shift	probably null
R7766:Kank1	UTSW	19	25411205	frame shift	probably null
R7768:Kank1	UTSW	19	25411205	frame shift	probably null
R7919:Kank1	UTSW	19	25431075	missense	probably damaging	1.00
R7974:Kank1	UTSW	19	25424220	missense	probably damaging	1.00
R7978:Kank1	UTSW	19	25411205	frame shift	probably null
R8017:Kank1	UTSW	19	25411205	frame shift	probably null
R8020:Kank1	UTSW	19	25411205	frame shift	probably null
R8150:Kank1	UTSW	19	25410799	missense	possibly damaging	0.88
R8322:Kank1	UTSW	19	25378478	start gained	probably benign
R8374:Kank1	UTSW	19	25411641	missense	probably damaging	0.97
R8705:Kank1	UTSW	19	25411543	missense	probably damaging	1.00
R8855:Kank1	UTSW	19	25411338	missense	possibly damaging	0.87
R8866:Kank1	UTSW	19	25411338	missense	possibly damaging	0.87
R8891:Kank1	UTSW	19	25410075	missense	probably benign	0.32
R8894:Kank1	UTSW	19	25431014	missense	probably damaging	1.00
R8917:Kank1	UTSW	19	25409564	missense	probably damaging	0.99
R9217:Kank1	UTSW	19	25409580	missense	possibly damaging	0.92
R9301:Kank1	UTSW	19	25411434	missense	probably benign	0.00
R9431:Kank1	UTSW	19	25410502	missense	probably damaging	1.00
R9603:Kank1	UTSW	19	25430925	missense	possibly damaging	0.95
R9680:Kank1	UTSW	19	25410774	missense	probably damaging	1.00
R9746:Kank1	UTSW	19	25409508	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTCTGCTTCCCCAAGGAG -3'
(R):5'- GTCCGCATTTTGAGACCAAC -3'

Sequencing Primer
(F):5'- TGCTTCCCCAAGGAGTGCAC -3'
(R):5'- CCGCATTTTGAGACCAACTAGATAG -3'

Posted On

2020-10-20