Mutagenetix > Incidental Mutation

Incidental Mutation 'R0375:Abca9'

65632

Institutional Source

Beutler Lab

Gene Symbol

Abca9

Ensembl Gene

ENSMUSG00000041797

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 9

Synonyms

D630040K07Rik

MMRRC Submission

038581-MU

Accession Numbers

NCBI RefSeq: NM_147220.2; MGI: 2386796

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0375 (G1)

Quality Score

134

Status

Validated

Chromosome

Chromosomal Location

110100749-110168196 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 110115447 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1277 (D1277E)

Ref Sequence

ENSEMBL: ENSMUSP00000036338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044850]

AlphaFold

Q8K449

Predicted Effect

probably benign
Transcript: ENSMUST00000044850
AA Change: D1277E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: D1277E

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	419	2.7e-31	PFAM
AAA	509	693	9.28e-12	SMART
low complexity region	817	837	N/A	INTRINSIC
transmembrane domain	862	884	N/A	INTRINSIC
Pfam:ABC2_membrane_3	918	1219	5.2e-15	PFAM
low complexity region	1250	1259	N/A	INTRINSIC
AAA	1317	1497	8.47e-6	SMART

Meta Mutation Damage Score

0.0701

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,046,252	T4707I	probably damaging	Het
5730522E02Rik	T	A	11: 25,769,092	Y17F	unknown	Het
Aars2	A	G	17: 45,514,550	D313G	probably damaging	Het
Adgrl1	G	T	8: 83,934,901	A981S	probably damaging	Het
Aff3	T	G	1: 38,204,940	K917Q	possibly damaging	Het
BC049715	A	T	6: 136,839,996	H78L	probably benign	Het
Cacna1g	C	A	11: 94,411,054	A2027S	possibly damaging	Het
Camk1g	G	A	1: 193,356,401		probably benign	Het
Carf	T	C	1: 60,144,002	V386A	probably damaging	Het
Cd46	A	G	1: 195,086,164	S82P	probably benign	Het
Clic5	A	G	17: 44,270,623	E180G	possibly damaging	Het
Col27a1	A	G	4: 63,225,661	T529A	probably benign	Het
Col7a1	C	T	9: 108,980,237	R2627C	unknown	Het
Cuzd1	G	A	7: 131,311,908		probably benign	Het
Cwc27	T	C	13: 104,807,823	D50G	possibly damaging	Het
Dhx38	A	G	8: 109,555,181	V735A	possibly damaging	Het
Dhx57	T	G	17: 80,258,121	E834A	probably damaging	Het
Dsg4	A	G	18: 20,470,879	D801G	probably damaging	Het
Dtx1	T	C	5: 120,681,399	E578G	probably damaging	Het
F830016B08Rik	A	T	18: 60,300,193	H116L	probably damaging	Het
Fam208b	A	G	13: 3,596,842	V61A	possibly damaging	Het
Fbxw18	T	C	9: 109,688,839	I360V	possibly damaging	Het
Fignl2	G	A	15: 101,054,093	P103S	probably benign	Het
Frmpd1	A	G	4: 45,284,196	T1006A	probably benign	Het
Ggnbp2	G	T	11: 84,836,374	C545*	probably null	Het
Gm3336	A	G	8: 70,718,645		probably benign	Het
Gpr37	T	C	6: 25,669,291	N518S	probably benign	Het
Hbs1l	T	A	10: 21,342,541	D312E	possibly damaging	Het
Hoxd10	C	A	2: 74,692,720	S247R	probably benign	Het
Ifnb1	A	T	4: 88,522,744	F11I	probably benign	Het
Marf1	T	C	16: 14,151,320		probably benign	Het
Myo1f	T	A	17: 33,601,956	V879E	probably benign	Het
Naip1	A	G	13: 100,409,148	F1291L	probably benign	Het
Nckap1l	A	G	15: 103,474,159	E529G	probably damaging	Het
Npm3	T	C	19: 45,748,229	E157G	probably damaging	Het
Olfr1200	T	A	2: 88,767,641	T225S	possibly damaging	Het
Olfr1240	G	T	2: 89,439,396	N294K	probably benign	Het
Olfr248	A	G	1: 174,391,209	T47A	probably damaging	Het
Pex16	G	A	2: 92,380,457	G312D	probably damaging	Het
Ppp6r1	A	G	7: 4,633,287	V768A	probably benign	Het
Prrc1	A	G	18: 57,362,492	T14A	probably damaging	Het
Ranbp2	T	C	10: 58,477,283	L1275P	probably damaging	Het
Rnf214	C	A	9: 45,899,823	V181F	probably damaging	Het
Ror2	T	C	13: 53,132,004	N58S	probably damaging	Het
Selplg	G	A	5: 113,820,008	T79I	probably damaging	Het
Setd1b	G	A	5: 123,157,437	G1023S	unknown	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Skint5	A	G	4: 113,705,596	V803A	unknown	Het
Slc25a46	T	C	18: 31,583,266	I394M	possibly damaging	Het
Snrnp27	A	T	6: 86,680,953	I101K	possibly damaging	Het
Spag17	C	A	3: 100,027,590	T704K	probably benign	Het
Tas2r144	T	A	6: 42,216,124	M266K	possibly damaging	Het
Tbc1d31	T	A	15: 57,955,350	L783H	probably benign	Het
Tbck	C	A	3: 132,751,232		probably benign	Het
Vcan	A	G	13: 89,691,275	V2050A	probably damaging	Het
Vmn1r70	T	A	7: 10,634,060	N158K	probably damaging	Het
Vmn2r103	T	A	17: 19,792,859	Y81N	probably benign	Het
Vmn2r103	A	G	17: 19,793,464	T173A	probably benign	Het
Ylpm1	T	G	12: 85,014,980	S552A	unknown	Het
Zdhhc17	A	T	10: 110,982,106	Y58*	probably null	Het

Other mutations in Abca9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Abca9	APN	11	110160516	missense	probably benign
IGL00467:Abca9	APN	11	110145670	splice site	probably benign
IGL00886:Abca9	APN	11	110163275	missense	possibly damaging	0.93
IGL01340:Abca9	APN	11	110130627	missense	probably benign
IGL01351:Abca9	APN	11	110148903	missense	probably damaging	0.99
IGL01383:Abca9	APN	11	110113293	splice site	probably benign
IGL01384:Abca9	APN	11	110145637	missense	probably damaging	1.00
IGL01482:Abca9	APN	11	110120773	missense	probably benign	0.05
IGL01586:Abca9	APN	11	110154417	missense	probably damaging	0.99
IGL01589:Abca9	APN	11	110155177	missense	probably damaging	1.00
IGL01926:Abca9	APN	11	110135329	splice site	probably benign
IGL02059:Abca9	APN	11	110160394	splice site	probably benign
IGL02084:Abca9	APN	11	110130597	missense	probably benign
IGL02096:Abca9	APN	11	110102533	missense	probably damaging	1.00
IGL02096:Abca9	APN	11	110165980	missense	probably benign	0.01
IGL02290:Abca9	APN	11	110135351	missense	probably damaging	1.00
IGL02303:Abca9	APN	11	110154550	missense	probably damaging	1.00
IGL02549:Abca9	APN	11	110102053	missense	probably damaging	1.00
IGL02687:Abca9	APN	11	110114232	missense	probably damaging	1.00
IGL02752:Abca9	APN	11	110127368	missense	probably damaging	1.00
IGL02814:Abca9	APN	11	110154467	missense	possibly damaging	0.90
IGL02878:Abca9	APN	11	110138329	missense	probably benign	0.01
IGL03088:Abca9	APN	11	110144261	missense	probably benign	0.06
IGL03231:Abca9	APN	11	110155268	missense	probably damaging	0.96
R0050:Abca9	UTSW	11	110145591	missense	probably damaging	1.00
R0050:Abca9	UTSW	11	110145591	missense	probably damaging	1.00
R0064:Abca9	UTSW	11	110144871	missense	probably damaging	1.00
R0064:Abca9	UTSW	11	110144872	missense	probably damaging	1.00
R0068:Abca9	UTSW	11	110145579	missense	probably damaging	0.99
R0189:Abca9	UTSW	11	110108653	missense	probably damaging	1.00
R0189:Abca9	UTSW	11	110141662	splice site	probably benign
R0601:Abca9	UTSW	11	110117058	critical splice donor site	probably null
R0624:Abca9	UTSW	11	110139620	missense	probably damaging	1.00
R0652:Abca9	UTSW	11	110152063	missense	probably benign	0.02
R1004:Abca9	UTSW	11	110151954	missense	possibly damaging	0.88
R1222:Abca9	UTSW	11	110145064	splice site	probably benign
R1451:Abca9	UTSW	11	110127447	missense	probably damaging	1.00
R1462:Abca9	UTSW	11	110160516	missense	probably benign
R1462:Abca9	UTSW	11	110160516	missense	probably benign
R1474:Abca9	UTSW	11	110145579	missense	probably damaging	0.99
R1499:Abca9	UTSW	11	110139632	missense	probably benign	0.00
R1778:Abca9	UTSW	11	110130716	nonsense	probably null
R2015:Abca9	UTSW	11	110131846	missense	probably benign	0.01
R2295:Abca9	UTSW	11	110148903	missense	probably damaging	0.99
R2303:Abca9	UTSW	11	110158226	missense	probably benign	0.01
R2403:Abca9	UTSW	11	110115454	missense	probably benign	0.16
R2886:Abca9	UTSW	11	110144886	splice site	probably benign
R3435:Abca9	UTSW	11	110154430	missense	probably benign	0.24
R3976:Abca9	UTSW	11	110148789	missense	probably benign	0.25
R4335:Abca9	UTSW	11	110152017	missense	probably damaging	1.00
R4411:Abca9	UTSW	11	110151955	missense	probably benign	0.00
R4613:Abca9	UTSW	11	110144784	missense	probably benign	0.26
R4690:Abca9	UTSW	11	110148880	missense	probably damaging	1.00
R4720:Abca9	UTSW	11	110127422	missense	probably damaging	1.00
R4751:Abca9	UTSW	11	110130570	missense	probably benign	0.00
R4797:Abca9	UTSW	11	110118119	missense	probably benign
R4818:Abca9	UTSW	11	110155154	critical splice donor site	probably null
R4903:Abca9	UTSW	11	110147001	missense	probably damaging	1.00
R4971:Abca9	UTSW	11	110152048	missense	probably benign	0.43
R4977:Abca9	UTSW	11	110136073	missense	probably benign	0.00
R5019:Abca9	UTSW	11	110165934	missense	probably benign
R5079:Abca9	UTSW	11	110145569	missense	possibly damaging	0.47
R5082:Abca9	UTSW	11	110131868	missense	probably benign
R5093:Abca9	UTSW	11	110141532	missense	probably damaging	0.98
R5212:Abca9	UTSW	11	110107226	missense	probably benign	0.02
R5350:Abca9	UTSW	11	110115538	missense	probably benign
R5368:Abca9	UTSW	11	110145546	missense	probably damaging	1.00
R5432:Abca9	UTSW	11	110141554	missense	possibly damaging	0.83
R5436:Abca9	UTSW	11	110134236	missense	probably damaging	1.00
R5497:Abca9	UTSW	11	110130692	missense	probably damaging	1.00
R5503:Abca9	UTSW	11	110141610	missense	probably damaging	1.00
R5594:Abca9	UTSW	11	110144862	missense	probably damaging	1.00
R5742:Abca9	UTSW	11	110160417	missense	probably damaging	0.98
R5776:Abca9	UTSW	11	110107460	splice site	probably null
R5781:Abca9	UTSW	11	110101987	missense	probably damaging	1.00
R5872:Abca9	UTSW	11	110117076	missense	possibly damaging	0.70
R5923:Abca9	UTSW	11	110160552	missense	probably benign	0.09
R6020:Abca9	UTSW	11	110145613	missense	possibly damaging	0.86
R6179:Abca9	UTSW	11	110134254	missense	probably benign	0.05
R6245:Abca9	UTSW	11	110135423	missense	probably damaging	1.00
R6249:Abca9	UTSW	11	110145627	missense	probably benign
R6365:Abca9	UTSW	11	110145655	missense	possibly damaging	0.63
R6385:Abca9	UTSW	11	110134254	missense	probably damaging	0.99
R6481:Abca9	UTSW	11	110165962	nonsense	probably null
R6675:Abca9	UTSW	11	110115476	missense	probably benign
R6909:Abca9	UTSW	11	110115497	missense	probably benign	0.01
R7390:Abca9	UTSW	11	110145661	missense	probably benign	0.01
R7429:Abca9	UTSW	11	110127426	frame shift	probably null
R7431:Abca9	UTSW	11	110127426	frame shift	probably null
R7621:Abca9	UTSW	11	110160533	missense	probably benign	0.00
R7623:Abca9	UTSW	11	110107558	missense	probably benign	0.27
R7660:Abca9	UTSW	11	110115452	missense	probably benign
R7784:Abca9	UTSW	11	110154417	nonsense	probably null
R7798:Abca9	UTSW	11	110138179	missense	probably benign	0.45
R7839:Abca9	UTSW	11	110134259	missense	probably benign	0.43
R7891:Abca9	UTSW	11	110163272	missense	probably benign	0.03
R7894:Abca9	UTSW	11	110106589	missense	possibly damaging	0.49
R8030:Abca9	UTSW	11	110120708	missense	probably benign
R8133:Abca9	UTSW	11	110127463	missense	possibly damaging	0.88
R8195:Abca9	UTSW	11	110138329	missense	probably benign	0.01
R8304:Abca9	UTSW	11	110107128	critical splice donor site	probably null
R8386:Abca9	UTSW	11	110130692	missense	probably damaging	1.00
R8390:Abca9	UTSW	11	110145630	missense	probably benign	0.01
R8692:Abca9	UTSW	11	110141583	missense	probably benign	0.11
R8721:Abca9	UTSW	11	110144289	missense	possibly damaging	0.82
R8738:Abca9	UTSW	11	110165991	start codon destroyed	probably null	1.00
R8900:Abca9	UTSW	11	110154392	missense	probably benign
R8948:Abca9	UTSW	11	110163380	critical splice acceptor site	probably null
R8950:Abca9	UTSW	11	110163380	critical splice acceptor site	probably null
R8964:Abca9	UTSW	11	110147249	nonsense	probably null
R9019:Abca9	UTSW	11	110120696	missense
R9034:Abca9	UTSW	11	110148789	missense	probably benign	0.25
R9035:Abca9	UTSW	11	110130635	missense	probably damaging	0.97
R9086:Abca9	UTSW	11	110102053	missense	probably damaging	1.00
R9199:Abca9	UTSW	11	110165944	missense	possibly damaging	0.49
R9402:Abca9	UTSW	11	110158328	missense	probably benign	0.14
R9414:Abca9	UTSW	11	110144274	missense	probably damaging	0.97
R9554:Abca9	UTSW	11	110138281	missense	probably benign
R9626:Abca9	UTSW	11	110120780	missense	probably benign	0.01
R9651:Abca9	UTSW	11	110115493	missense	probably benign	0.09
R9665:Abca9	UTSW	11	110115454	missense	probably benign
R9665:Abca9	UTSW	11	110115455	missense	probably benign	0.00
R9731:Abca9	UTSW	11	110134198	missense	probably benign
Z1176:Abca9	UTSW	11	110135375	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GCTTGTGGACACTGCATACCTACTG -3'
(R):5'- GCTGCCTTGATATCCACTGACAGAG -3'

Sequencing Primer
(F):5'- TACTGACATCAAGGAATGCACTG -3'
(R):5'- TAGCAGCATCGTTTGACCAG -3'

Protein Function and Prediction

Abca9 encodes ABCA9, a member of the A subfamily of ATP-binding cassette (ABC) transporters that function to translocate molecules across cellular membranes. ABCA9 has up to 7 transmembane segments in two transmembrane domains as well as two nucleotide-binding domains. The nucleotide-binding domains contain three motifs: Walker A and B motifs (1). ABCA9 is ubiquitously expressed in humans, with highest levels in the adult hear, brain, and liver (1). ABCA9 is suppressed by cholesterol import and induced during monocyte differentiation (1). ABCA9 is proposed to function in monocyte differentiation and macrophage lipid homeostasis (1).

References

1. Piehler, A., Kaminski, W. E., Wenzel, J. J., Langmann, T., and Schmitz, G. (2002) Molecular Structure of a Novel Cholesterol-Responsive A Subclass ABC Transporter, ABCA9. Biochem Biophys Res Commun. 295, 408-416.

Posted On

2013-08-08

Science Writer

Anne Murray