Incidental Mutation 'R8226:Dennd5b'
ID 656342
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 067643-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R8226 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 148915746 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
AlphaFold A2RSQ0
Predicted Effect probably null
Transcript: ENSMUST00000111557
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.7%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,094,195 (GRCm39) N27S probably damaging Het
Abcb1b T A 5: 8,871,390 (GRCm39) Y315N probably damaging Het
Acy1 A G 9: 106,314,857 (GRCm39) I22T probably damaging Het
Akap11 G A 14: 78,748,649 (GRCm39) T1246M Het
Akr1b1 G C 6: 34,288,867 (GRCm39) T114R probably damaging Het
Apob G A 12: 8,059,056 (GRCm39) V2513I probably benign Het
Arhgap21 C T 2: 20,876,556 (GRCm39) D820N probably damaging Het
Arl2 A T 19: 6,187,506 (GRCm39) probably null Het
Bmp5 C T 9: 75,683,606 (GRCm39) P78S probably damaging Het
Cic T C 7: 24,987,213 (GRCm39) C1374R probably damaging Het
Dhx36 A G 3: 62,377,991 (GRCm39) Y1000H probably benign Het
Dnah14 A G 1: 181,623,110 (GRCm39) E3996G possibly damaging Het
Efcab6 T C 15: 83,788,456 (GRCm39) Y946C probably benign Het
Egfem1 A G 3: 29,711,404 (GRCm39) K328E probably damaging Het
F5 T C 1: 164,021,959 (GRCm39) V1478A probably benign Het
Fchsd2 C T 7: 100,931,679 (GRCm39) P745L probably damaging Het
Grb10 G T 11: 11,901,533 (GRCm39) L214M probably damaging Het
H6pd A G 4: 150,080,446 (GRCm39) V133A probably benign Het
Irak4 T A 15: 94,456,244 (GRCm39) L277Q probably damaging Het
Krt78 A T 15: 101,855,480 (GRCm39) M777K possibly damaging Het
Lrch4 A G 5: 137,637,997 (GRCm39) H93R Het
Lrrc38 G A 4: 143,077,303 (GRCm39) G189R probably damaging Het
Mga A G 2: 119,790,866 (GRCm39) I2251V probably benign Het
Mtx3 A G 13: 92,984,215 (GRCm39) E164G possibly damaging Het
Muc21 T C 17: 35,930,599 (GRCm39) probably benign Het
Nbeal1 A T 1: 60,316,336 (GRCm39) K1846N probably damaging Het
Nedd1 T A 10: 92,527,797 (GRCm39) M466L probably benign Het
Nr4a3 A T 4: 48,056,588 (GRCm39) K380M probably damaging Het
Nup107 T C 10: 117,593,836 (GRCm39) K786E probably benign Het
Or51f23b T C 7: 102,402,950 (GRCm39) Y62C probably benign Het
Or5ak25 T A 2: 85,268,981 (GRCm39) I174F probably damaging Het
Or5m12 T C 2: 85,734,547 (GRCm39) I284V probably benign Het
Or5v1 A T 17: 37,809,560 (GRCm39) Q6L probably benign Het
Pira13 A C 7: 3,828,109 (GRCm39) L66R Het
Pkhd1l1 A G 15: 44,437,803 (GRCm39) N3533D possibly damaging Het
Plpp1 A T 13: 113,003,465 (GRCm39) T230S probably benign Het
Plxnc1 A C 10: 94,669,230 (GRCm39) D1063E possibly damaging Het
Pramel20 T G 4: 143,298,530 (GRCm39) Y158D probably benign Het
Prokr2 C A 2: 132,215,961 (GRCm39) A167S probably damaging Het
Qser1 C T 2: 104,619,070 (GRCm39) A491T probably benign Het
Rc3h2 T A 2: 37,267,001 (GRCm39) Y1040F possibly damaging Het
Rgl2 C T 17: 34,151,501 (GRCm39) L182F possibly damaging Het
Rnf130 T C 11: 49,962,097 (GRCm39) V181A probably benign Het
Scd4 A G 19: 44,322,572 (GRCm39) D55G probably benign Het
Scn7a T G 2: 66,531,204 (GRCm39) I558L possibly damaging Het
Serpinb7 G A 1: 107,375,980 (GRCm39) probably null Het
Shtn1 T C 19: 58,992,328 (GRCm39) I417V possibly damaging Het
Svs3b T A 2: 164,098,140 (GRCm39) E60D possibly damaging Het
Tex14 T C 11: 87,375,585 (GRCm39) I116T probably damaging Het
Trak1 C T 9: 121,280,793 (GRCm39) T394I probably benign Het
Trhde C T 10: 114,403,133 (GRCm39) V497M probably damaging Het
Trpc2 A G 7: 101,737,482 (GRCm39) M425V possibly damaging Het
Trpm2 C T 10: 77,783,807 (GRCm39) R222Q probably damaging Het
Tuba1b C T 15: 98,829,591 (GRCm39) G410S probably benign Het
Usp28 T G 9: 48,926,697 (GRCm39) probably null Het
Vps13d T C 4: 144,875,860 (GRCm39) Y1555C Het
Wdr17 T A 8: 55,146,155 (GRCm39) N106Y possibly damaging Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCTGCTCATCTGAAAAC -3'
(R):5'- ACCAACTCACTAGTTCAAGAGG -3'

Sequencing Primer
(F):5'- GCCTGCTCATCTGAAAACTGTTTAC -3'
(R):5'- TACAGATCGTTGTGAGCCAC -3'
Posted On 2020-10-23