Incidental Mutation 'R8248:Rgs6'
ID656348
Institutional Source Beutler Lab
Gene Symbol Rgs6
Ensembl Gene ENSMUSG00000021219
Gene Nameregulator of G-protein signaling 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location82588292-83162056 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 83137704 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101234] [ENSMUST00000185665] [ENSMUST00000185674] [ENSMUST00000186081] [ENSMUST00000186309] [ENSMUST00000186323] [ENSMUST00000186458] [ENSMUST00000186848] [ENSMUST00000191107] [ENSMUST00000191311] [ENSMUST00000191352] [ENSMUST00000200911] [ENSMUST00000202210]
Predicted Effect probably benign
Transcript: ENSMUST00000101234
SMART Domains Protein: ENSMUSP00000098793
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185665
SMART Domains Protein: ENSMUSP00000139566
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185674
SMART Domains Protein: ENSMUSP00000139940
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186081
SMART Domains Protein: ENSMUSP00000140188
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
low complexity region 417 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186309
SMART Domains Protein: ENSMUSP00000140701
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
low complexity region 494 499 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186323
SMART Domains Protein: ENSMUSP00000141079
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186458
SMART Domains Protein: ENSMUSP00000139735
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186848
SMART Domains Protein: ENSMUSP00000141044
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 5 80 1.6e-26 SMART
G_gamma 220 284 1.1e-27 SMART
GGL 223 284 8.8e-30 SMART
RGS 301 416 7.6e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191107
SMART Domains Protein: ENSMUSP00000139725
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191311
SMART Domains Protein: ENSMUSP00000140723
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191352
SMART Domains Protein: ENSMUSP00000139718
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200911
SMART Domains Protein: ENSMUSP00000143801
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201767
Predicted Effect probably benign
Transcript: ENSMUST00000202210
SMART Domains Protein: ENSMUSP00000143961
Gene: ENSMUSG00000021219

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a member of the RGS (regulator of G protein signaling) family of proteins, which are defined by the presence of a RGS domain that confers the GTPase-activating activity of these proteins toward certain G alpha subunits. This protein also belongs to a subfamily of RGS proteins characterized by the presence of DEP (Dishevelled, Egl-10, and Pleckstrin) and GGL (G-protein gamma like)domains, the latter a G beta 5-interacting domain. The RGS proteins negatively regulate G protein signaling, and may modulate neuronal, cardiovascular, lymphocytic activities, and cancer risk. Mice lacking this gene exhibit decreased heart rate. Alternative splicing results in multiple transcript variants, however, the full-length nature of some of these variants is not known. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased heart rate and abnormal impulse conducting system conduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Rgs6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Rgs6 APN 12 83051323 missense probably benign 0.01
IGL02131:Rgs6 APN 12 83069495 missense probably damaging 1.00
IGL02354:Rgs6 APN 12 82618619 intron probably benign
IGL02361:Rgs6 APN 12 82618619 intron probably benign
IGL02568:Rgs6 APN 12 83070602 missense probably benign 0.25
IGL02598:Rgs6 APN 12 83091797 missense probably benign 0.02
IGL03146:Rgs6 APN 12 83052538 missense probably damaging 1.00
IGL03248:Rgs6 APN 12 83052550 splice site probably benign
IGL03098:Rgs6 UTSW 12 82985376 missense probably damaging 1.00
IGL03147:Rgs6 UTSW 12 83091846 missense probably damaging 0.99
PIT4453001:Rgs6 UTSW 12 83091779 missense probably damaging 1.00
R0270:Rgs6 UTSW 12 83133689 missense probably damaging 1.00
R0390:Rgs6 UTSW 12 83133677 missense probably damaging 1.00
R0540:Rgs6 UTSW 12 83059804 nonsense probably null
R0630:Rgs6 UTSW 12 83047550 splice site probably benign
R1479:Rgs6 UTSW 12 83116244 missense probably damaging 1.00
R1533:Rgs6 UTSW 12 83091773 missense probably benign 0.00
R1545:Rgs6 UTSW 12 83116177 missense probably damaging 0.99
R2161:Rgs6 UTSW 12 83091804 missense probably damaging 1.00
R2421:Rgs6 UTSW 12 83116283 missense possibly damaging 0.93
R4089:Rgs6 UTSW 12 83063487 missense probably damaging 1.00
R4573:Rgs6 UTSW 12 83066015 missense probably damaging 1.00
R4821:Rgs6 UTSW 12 83067411 critical splice acceptor site probably null
R6228:Rgs6 UTSW 12 83065964 missense probably damaging 0.99
R7023:Rgs6 UTSW 12 83092104 intron probably benign
R7585:Rgs6 UTSW 12 83106870 missense probably damaging 1.00
R7610:Rgs6 UTSW 12 83091779 missense probably damaging 1.00
R7798:Rgs6 UTSW 12 83069519 missense probably benign 0.02
R8003:Rgs6 UTSW 12 82985370 missense probably damaging 0.99
R8011:Rgs6 UTSW 12 83116292 missense probably null 0.32
R8081:Rgs6 UTSW 12 83047573 nonsense probably null
R8267:Rgs6 UTSW 12 82651895 missense probably benign
R8285:Rgs6 UTSW 12 83116175 missense probably benign 0.14
RF008:Rgs6 UTSW 12 83063449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTCAGCTGGTTGTCTGC -3'
(R):5'- TACTGTCGGGGTTCACAGAG -3'

Sequencing Primer
(F):5'- AGCTGGTTGTCTGCCCTCC -3'
(R):5'- CACAGAGGGACATTTGGATTTTC -3'
Posted On2020-10-23