Incidental Mutation 'R8248:Kdm1b'
ID656349
Institutional Source Beutler Lab
Gene Symbol Kdm1b
Ensembl Gene ENSMUSG00000038080
Gene Namelysine (K)-specific demethylase 1B
Synonyms4632428N09Rik, Aof1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R8248 (G1)
Quality Score219.009
Status Validated
Chromosome13
Chromosomal Location47043499-47085279 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 47071878 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000037025]
Predicted Effect probably benign
Transcript: ENSMUST00000037025
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143518
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes are viable, grossly normal and male mice are fertile; however, heterozygous progeny of homozygous null mothers display severe placental defects, embryonic growth impairment, neural tube defects and pericardial edema, and do not survive past E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Kdm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Kdm1b APN 13 47068540 missense probably benign 0.01
IGL00924:Kdm1b APN 13 47068480 missense probably benign
IGL01553:Kdm1b APN 13 47080548 missense probably damaging 0.96
IGL01663:Kdm1b APN 13 47073737 missense probably damaging 0.99
IGL02385:Kdm1b APN 13 47068506 missense possibly damaging 0.49
IGL02505:Kdm1b APN 13 47060855 missense probably damaging 1.00
IGL02826:Kdm1b APN 13 47080467 missense probably damaging 1.00
IGL03257:Kdm1b APN 13 47049266 missense probably damaging 1.00
R0052:Kdm1b UTSW 13 47064117 missense probably damaging 1.00
R0319:Kdm1b UTSW 13 47053719 missense probably benign
R0426:Kdm1b UTSW 13 47064244 splice site probably benign
R0599:Kdm1b UTSW 13 47058810 missense possibly damaging 0.47
R0764:Kdm1b UTSW 13 47068603 missense possibly damaging 0.70
R1163:Kdm1b UTSW 13 47071922 missense probably benign 0.02
R1543:Kdm1b UTSW 13 47068521 missense probably damaging 0.99
R1584:Kdm1b UTSW 13 47064054 missense probably damaging 1.00
R1627:Kdm1b UTSW 13 47064231 critical splice donor site probably null
R1669:Kdm1b UTSW 13 47068548 missense probably damaging 1.00
R1758:Kdm1b UTSW 13 47060768 missense probably benign 0.00
R1860:Kdm1b UTSW 13 47049190 missense probably benign 0.03
R1907:Kdm1b UTSW 13 47064120 missense probably benign 0.00
R2225:Kdm1b UTSW 13 47064088 frame shift probably null
R2239:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2271:Kdm1b UTSW 13 47064088 frame shift probably null
R2302:Kdm1b UTSW 13 47064088 frame shift probably null
R2303:Kdm1b UTSW 13 47064088 frame shift probably null
R2380:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2442:Kdm1b UTSW 13 47062975 missense probably benign 0.32
R3022:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3054:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3545:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3546:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4094:Kdm1b UTSW 13 47063020 missense probably damaging 1.00
R4419:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4420:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4502:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4547:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4785:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4793:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4804:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4882:Kdm1b UTSW 13 47060893 missense probably benign
R4906:Kdm1b UTSW 13 47063144 critical splice donor site probably null
R4965:Kdm1b UTSW 13 47074367 missense probably damaging 0.98
R5039:Kdm1b UTSW 13 47077486 missense probably damaging 1.00
R5098:Kdm1b UTSW 13 47062991 missense probably damaging 1.00
R5265:Kdm1b UTSW 13 47062969 missense probably benign 0.35
R5541:Kdm1b UTSW 13 47079196 missense probably damaging 1.00
R5814:Kdm1b UTSW 13 47063146 splice site probably null
R6046:Kdm1b UTSW 13 47079253 missense possibly damaging 0.92
R6798:Kdm1b UTSW 13 47068536 missense probably benign 0.00
R6903:Kdm1b UTSW 13 47074404 missense probably benign 0.00
R7831:Kdm1b UTSW 13 47050622 missense probably benign 0.17
R7973:Kdm1b UTSW 13 47077446 missense probably benign 0.00
R8181:Kdm1b UTSW 13 47051901 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGATCTCAACCCGTCTTAAGGTG -3'
(R):5'- AGTGTGTCACGGACCACTTC -3'

Sequencing Primer
(F):5'- CAACCCGTCTTAAGGTGTAGCTG -3'
(R):5'- TCACGGACCACTTCAGGCC -3'
Posted On2020-10-23