Incidental Mutation 'R7952:D3Ertd751e'
ID656356
Institutional Source Beutler Lab
Gene Symbol D3Ertd751e
Ensembl Gene ENSMUSG00000025766
Gene NameDNA segment, Chr 3, ERATO Doi 751, expressed
Synonyms4930415G15Rik, 2810009O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7952 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location41742611-41803320 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 41748661 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142037 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000026867
Predicted Effect probably null
Transcript: ENSMUST00000026867
Predicted Effect probably null
Transcript: ENSMUST00000026868
Predicted Effect probably null
Transcript: ENSMUST00000026868
Predicted Effect probably null
Transcript: ENSMUST00000108065
Predicted Effect probably null
Transcript: ENSMUST00000108065
Predicted Effect probably null
Transcript: ENSMUST00000119572
Predicted Effect probably null
Transcript: ENSMUST00000119572
Predicted Effect probably null
Transcript: ENSMUST00000120167
Predicted Effect probably null
Transcript: ENSMUST00000120167
Predicted Effect probably benign
Transcript: ENSMUST00000143841
Predicted Effect probably null
Transcript: ENSMUST00000146165
Predicted Effect probably null
Transcript: ENSMUST00000146165
Predicted Effect probably null
Transcript: ENSMUST00000192193
Predicted Effect probably null
Transcript: ENSMUST00000192193
Predicted Effect probably null
Transcript: ENSMUST00000193075
Predicted Effect probably null
Transcript: ENSMUST00000193075
Predicted Effect probably benign
Transcript: ENSMUST00000193228
Predicted Effect probably null
Transcript: ENSMUST00000194346
Predicted Effect probably null
Transcript: ENSMUST00000194346
Predicted Effect probably benign
Transcript: ENSMUST00000195030
Predicted Effect probably null
Transcript: ENSMUST00000195882
Predicted Effect probably null
Transcript: ENSMUST00000195882
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Adora1 A G 1: 134,203,286 S216P possibly damaging Het
Arhgap17 G T 7: 123,286,691 S739R probably benign Het
Bphl A G 13: 34,046,797 T75A probably benign Het
Ccdc73 G A 2: 104,945,456 probably null Het
Cela3b T C 4: 137,421,908 I262V probably benign Het
Chpf T C 1: 75,478,942 N55S probably benign Het
Chst8 A G 7: 34,675,494 Y307H probably damaging Het
Cmtm2b G T 8: 104,330,571 E188* probably null Het
Cmya5 TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG 13: 93,097,004 probably benign Het
Cxadr C T 16: 78,334,235 T213M possibly damaging Het
Dhx32 T C 7: 133,748,996 Y115C probably benign Het
Dopey2 C A 16: 93,749,960 T284K possibly damaging Het
Dync2h1 A G 9: 7,129,802 V1732A possibly damaging Het
Egf C T 3: 129,739,996 R65Q probably damaging Het
Fat4 T G 3: 38,891,721 S1588A probably damaging Het
Fmnl3 A G 15: 99,322,637 V588A probably damaging Het
Galnt3 C T 2: 66,097,842 E237K probably benign Het
Gm7682 T C 5: 94,447,043 V254A probably benign Het
Grik2 T C 10: 49,422,537 I363V probably benign Het
Grik3 C T 4: 125,704,547 T769I probably damaging Het
Hpd A T 5: 123,178,264 D141E possibly damaging Het
Hrc A T 7: 45,336,268 D281V probably damaging Het
Igfn1 A T 1: 135,963,955 I2274K probably damaging Het
Iqgap3 A G 3: 88,098,370 I502V probably benign Het
Kcnh8 A T 17: 52,959,465 Q835L probably benign Het
Kmt2d C T 15: 98,850,768 G2892R unknown Het
Lama4 T G 10: 39,030,490 I284S probably benign Het
Madd C A 2: 91,162,541 G1011V probably damaging Het
Mroh2b T C 15: 4,951,211 F1421L probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nedd9 C A 13: 41,316,955 D241Y probably damaging Het
Notch2 T C 3: 98,100,236 V434A probably benign Het
Ofcc1 C T 13: 40,280,305 R108Q probably benign Het
Olfr118 T C 17: 37,672,817 Y265H probably damaging Het
Olfr578 A G 7: 102,984,514 F217L probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prss55 A G 14: 64,075,683 Y251H probably damaging Het
Rec8 T C 14: 55,625,303 V573A possibly damaging Het
Ryr2 T C 13: 11,646,427 probably null Het
Sec31b A G 19: 44,520,540 S667P probably benign Het
Smim17 A G 7: 6,424,850 D45G possibly damaging Het
Sspo A G 6: 48,487,329 T3906A probably damaging Het
Tanc2 G T 11: 105,896,597 G908W probably damaging Het
Tcf7l2 A T 19: 55,898,557 M1L probably benign Het
Tcrg-C4 T A 13: 19,349,570 S121R Het
Tpx2 C T 2: 152,893,594 A714V probably damaging Het
Trmt1 G A 8: 84,689,340 R9H possibly damaging Het
Unc13a A T 8: 71,658,487 V360E possibly damaging Het
Vmn1r225 T A 17: 20,502,327 I10N probably damaging Het
Xkr4 A G 1: 3,670,619 S244P possibly damaging Het
Zkscan14 G T 5: 145,195,898 H274Q probably damaging Het
Other mutations in D3Ertd751e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:D3Ertd751e APN 3 41748697 missense probably benign 0.04
IGL02484:D3Ertd751e APN 3 41753720 splice site probably null
IGL02587:D3Ertd751e APN 3 41753852 missense probably benign
IGL03173:D3Ertd751e APN 3 41756062 missense probably damaging 1.00
IGL03304:D3Ertd751e APN 3 41746729 critical splice donor site probably null
Terre UTSW 3 41758409 splice site probably null
R0239:D3Ertd751e UTSW 3 41753878 missense probably damaging 1.00
R0239:D3Ertd751e UTSW 3 41753878 missense probably damaging 1.00
R4275:D3Ertd751e UTSW 3 41756154 utr 3 prime probably benign
R6350:D3Ertd751e UTSW 3 41753843 missense probably damaging 1.00
R7001:D3Ertd751e UTSW 3 41758409 splice site probably null
R7134:D3Ertd751e UTSW 3 41753777 critical splice donor site probably null
R7179:D3Ertd751e UTSW 3 41748708 missense probably damaging 0.96
R7318:D3Ertd751e UTSW 3 41802551 splice site probably null
R7358:D3Ertd751e UTSW 3 41746565 missense probably damaging 0.99
R7632:D3Ertd751e UTSW 3 41753728 missense probably benign 0.00
R7896:D3Ertd751e UTSW 3 41756073 missense probably benign 0.01
R8714:D3Ertd751e UTSW 3 41746563 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGTGAAGAAATGTTGATTGCCC -3'
(R):5'- TGACCTCTACTTAGCTGAACTTAG -3'

Sequencing Primer
(F):5'- TGGCCTCACCATCACTAGG -3'
(R):5'- CCTCTACTTAGCTGAACTTAGTAAAC -3'
Posted On2020-10-28