Incidental Mutation 'R7941:Gad1'
ID656366
Institutional Source Beutler Lab
Gene Symbol Gad1
Ensembl Gene ENSMUSG00000070880
Gene Nameglutamate decarboxylase 1
SynonymsGAD25, GAD67, Gad-1, Z49976, GAD44, EP10
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location70553072-70602014 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 70594585 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094934]
Predicted Effect probably null
Transcript: ENSMUST00000094934
SMART Domains Protein: ENSMUSP00000092539
Gene: ENSMUSG00000070880

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Pyridoxal_deC 143 517 7e-154 PFAM
Pfam:Beta_elim_lyase 231 375 3.2e-6 PFAM
Pfam:Aminotran_5 273 380 2.4e-6 PFAM
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: The protein encoded by this gene is an enzyme that catalyzes the production of gamma-aminobutyric acid from L-glutamic acid. Alternative splicing of this gene results in two products, the predominant 67 kDa isoform and a smaller 25 kDa isoform. The smaller isoform is not thought to retain catalytic activity. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations die at birth with cleft palate and apnea and exhibit reduced levels of glutamic acid decarboxylase and gamma-aminobutyric acid in the cerebral cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rab24 C T 13: 55,320,307 probably null Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Gad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01794:Gad1 APN 2 70597168 missense probably benign
IGL01907:Gad1 APN 2 70574126 missense possibly damaging 0.64
IGL02596:Gad1 APN 2 70594684 missense probably damaging 1.00
IGL02654:Gad1 APN 2 70572781 missense possibly damaging 0.88
IGL02998:Gad1 APN 2 70589819 missense probably damaging 1.00
PIT4581001:Gad1 UTSW 2 70599667 missense probably benign 0.05
R0102:Gad1 UTSW 2 70587239 critical splice donor site probably null
R0454:Gad1 UTSW 2 70579201 missense probably damaging 1.00
R0576:Gad1 UTSW 2 70594652 missense probably benign 0.27
R1386:Gad1 UTSW 2 70574123 missense possibly damaging 0.88
R1677:Gad1 UTSW 2 70574177 missense probably damaging 1.00
R1842:Gad1 UTSW 2 70574253 missense probably benign 0.12
R1907:Gad1 UTSW 2 70579138 missense possibly damaging 0.79
R1933:Gad1 UTSW 2 70587392 missense possibly damaging 0.91
R3029:Gad1 UTSW 2 70594690 missense probably benign
R4085:Gad1 UTSW 2 70589848 missense probably benign 0.36
R4321:Gad1 UTSW 2 70589830 missense probably damaging 1.00
R4324:Gad1 UTSW 2 70589830 missense probably damaging 1.00
R4687:Gad1 UTSW 2 70600720 missense possibly damaging 0.94
R4986:Gad1 UTSW 2 70600693 missense probably benign
R5387:Gad1 UTSW 2 70563851 nonsense probably null
R5603:Gad1 UTSW 2 70589829 missense probably damaging 0.98
R6500:Gad1 UTSW 2 70593436 missense probably damaging 0.98
R7146:Gad1 UTSW 2 70587362 missense probably benign 0.00
R7352:Gad1 UTSW 2 70594750 missense probably benign 0.00
R7559:Gad1 UTSW 2 70563912 critical splice donor site probably null
R7579:Gad1 UTSW 2 70587132 missense possibly damaging 0.90
R7809:Gad1 UTSW 2 70597259 missense possibly damaging 0.80
R8290:Gad1 UTSW 2 70574266 missense probably benign 0.00
R8353:Gad1 UTSW 2 70600713 missense probably benign 0.00
R8453:Gad1 UTSW 2 70600713 missense probably benign 0.00
X0026:Gad1 UTSW 2 70589866 missense probably benign 0.00
Z1177:Gad1 UTSW 2 70579130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCAGATGTCTCTTAGAGGG -3'
(R):5'- TTGCTTTCCACATCAGCCAG -3'

Sequencing Primer
(F):5'- CAGTGAGGCCCTTGTTTTAGACATC -3'
(R):5'- TCAGCCAGAACTTGAAGATGTC -3'
Posted On2020-10-29