Incidental Mutation 'R7941:Rab24'
ID656368
Institutional Source Beutler Lab
Gene Symbol Rab24
Ensembl Gene ENSMUSG00000034789
Gene NameRAB24, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7941 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location55319743-55321946 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 55320307 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021941] [ENSMUST00000021942] [ENSMUST00000035242] [ENSMUST00000099490] [ENSMUST00000224685] [ENSMUST00000224973]
Predicted Effect probably benign
Transcript: ENSMUST00000021941
SMART Domains Protein: ENSMUSP00000021941
Gene: ENSMUSG00000021485

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
HLH 63 115 5.8e-11 SMART
low complexity region 119 138 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021942
SMART Domains Protein: ENSMUSP00000021942
Gene: ENSMUSG00000021486

DomainStartEndE-ValueType
Pfam:PRELI 16 172 1.9e-61 PFAM
coiled coil region 178 215 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035242
SMART Domains Protein: ENSMUSP00000046188
Gene: ENSMUSG00000034789

DomainStartEndE-ValueType
RAB 8 175 2.39e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099490
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224685
Predicted Effect probably benign
Transcript: ENSMUST00000224973
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAB24 is a small GTPase of the Rab subfamily of Ras-related proteins that regulate intracellular protein trafficking (Olkkonen et al., 1993 [PubMed 8126105]).[supplied by OMIM, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,689,679 probably benign Het
AI467606 A G 7: 127,092,421 E56G probably damaging Het
Ak9 C T 10: 41,409,137 P1403S unknown Het
Akr1c14 A G 13: 4,059,713 K28E probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Anks1b A T 10: 90,577,155 N55I probably damaging Het
C87414 A T 5: 93,638,028 V131D probably benign Het
Cabyr T C 18: 12,744,768 L54P probably damaging Het
Cachd1 A T 4: 100,988,173 N954I probably damaging Het
Cenpf A G 1: 189,657,286 S1450P probably damaging Het
Chst10 T A 1: 38,871,691 I131L probably damaging Het
Cluh A T 11: 74,659,757 M270L probably benign Het
Dagla T C 19: 10,271,503 H29R probably damaging Het
Dusp5 A G 19: 53,537,533 N202S probably benign Het
Elavl3 A G 9: 22,036,316 I110T possibly damaging Het
Fam222b G T 11: 78,155,059 G482V possibly damaging Het
Fbxl7 A G 15: 26,543,613 L316P probably damaging Het
Gad1 T A 2: 70,594,585 probably null Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hmcn1 A G 1: 150,650,084 V3296A possibly damaging Het
Hyal1 T C 9: 107,578,100 F203S probably damaging Het
Il16 T A 7: 83,682,829 D181V probably damaging Het
Ip6k1 T C 9: 108,024,432 F69L probably damaging Het
Klf4 G A 4: 55,531,755 probably benign Het
Lsr T G 7: 30,973,095 I27L probably benign Het
Mettl4 A T 17: 94,733,194 probably null Het
Mpdz A G 4: 81,282,750 V1902A probably benign Het
Nfkbiz C T 16: 55,821,944 G37D probably damaging Het
Olfr1131 T C 2: 87,628,904 V31A probably benign Het
Otogl A T 10: 107,806,802 probably null Het
Pcdh1 T C 18: 38,199,080 D429G probably damaging Het
Prelid2 A T 18: 41,932,751 L73* probably null Het
Psg20 T A 7: 18,681,177 probably null Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rag1 T G 2: 101,642,346 K817T probably benign Het
Rgl2 T C 17: 33,931,739 V57A probably benign Het
Ric1 T C 19: 29,533,259 M80T probably damaging Het
Sh3rf3 T C 10: 59,007,061 I283T probably damaging Het
Skint2 C A 4: 112,625,990 N197K probably damaging Het
Snapc4 A G 2: 26,376,718 I126T probably damaging Het
Srcap GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT 7: 127,558,290 probably benign Het
Svip T C 7: 52,003,413 K51R probably benign Het
Syndig1 T A 2: 149,899,788 V98E probably benign Het
Tshz1 A T 18: 84,015,392 M297K possibly damaging Het
Ttn A G 2: 76,919,350 V3785A probably benign Het
Usf3 T C 16: 44,215,561 S135P probably damaging Het
Vmn2r10 A T 5: 108,996,440 M548K probably damaging Het
Vmn2r92 T C 17: 18,184,837 S748P possibly damaging Het
Zbtb39 A G 10: 127,743,540 Y661C probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Zscan4-ps2 A G 7: 11,517,672 I212V probably benign Het
Other mutations in Rab24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0518:Rab24 UTSW 13 55320925 critical splice donor site probably null
R0521:Rab24 UTSW 13 55320925 critical splice donor site probably null
R3871:Rab24 UTSW 13 55321179 missense probably damaging 1.00
R5935:Rab24 UTSW 13 55320530 missense probably damaging 1.00
R5964:Rab24 UTSW 13 55321576 missense probably damaging 1.00
R7528:Rab24 UTSW 13 55321108 missense probably damaging 1.00
R8044:Rab24 UTSW 13 55321532 unclassified probably benign
V1024:Rab24 UTSW 13 55320748 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AATTCCACTGGGCCAGATGAG -3'
(R):5'- TTGAAACATCCAGCAAGACAGG -3'

Sequencing Primer
(F):5'- GTGGTGACTCAGTGATGACAAC -3'
(R):5'- CTTGGGTCCTGTCAGCAG -3'
Posted On2020-10-29