Incidental Mutation 'R7921:Col22a1'
ID 656382
Institutional Source Beutler Lab
Gene Symbol Col22a1
Ensembl Gene ENSMUSG00000079022
Gene Name collagen, type XXII, alpha 1
Synonyms C80743, 2310067L16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7921 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 71795795-72034227 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 71981962 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159993]
AlphaFold E9Q7P1
Predicted Effect probably null
Transcript: ENSMUST00000159993
SMART Domains Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
VWA 45 227 1.35e-51 SMART
TSPN 248 436 1.26e-33 SMART
low complexity region 454 470 N/A INTRINSIC
internal_repeat_3 494 555 1.96e-13 PROSPERO
internal_repeat_1 496 643 1.49e-19 PROSPERO
low complexity region 644 657 N/A INTRINSIC
low complexity region 673 707 N/A INTRINSIC
Pfam:Collagen 751 823 1.5e-9 PFAM
Pfam:Collagen 810 863 2.3e-10 PFAM
Pfam:Collagen 869 931 4.8e-11 PFAM
Pfam:Collagen 926 990 1.1e-10 PFAM
Pfam:Collagen 1031 1087 1.7e-10 PFAM
Pfam:Collagen 1104 1162 1.8e-11 PFAM
low complexity region 1173 1227 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
internal_repeat_2 1257 1348 3.25e-18 PROSPERO
internal_repeat_4 1268 1347 9.67e-7 PROSPERO
Pfam:Collagen 1389 1448 4e-10 PFAM
Pfam:Collagen 1481 1540 2.6e-9 PFAM
low complexity region 1546 1558 N/A INTRINSIC
low complexity region 1580 1590 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (84/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,677,995 M1426R probably benign Het
Adh7 A T 3: 138,224,010 Y149F probably damaging Het
Ankdd1b C A 13: 96,424,780 V319F possibly damaging Het
Ankrd13d T C 19: 4,271,030 D483G probably damaging Het
Anks4b A T 7: 120,182,769 E341V probably benign Het
Aqp12 A G 1: 93,012,008 H253R probably benign Het
Atp2c1 A G 9: 105,414,687 I892T probably damaging Het
Atp8b3 A T 10: 80,530,603 N275K probably damaging Het
Carmil2 C A 8: 105,691,104 N610K probably damaging Het
Cd96 GCCCAAAC G 16: 46,038,480 probably null Het
Cdh10 A T 15: 18,991,956 I434F probably damaging Het
Celf1 A T 2: 90,998,747 Q53L probably benign Het
Cers4 T A 8: 4,515,704 V50E probably damaging Het
Chd9 T C 8: 91,042,281 probably null Het
Cir1 A G 2: 73,310,455 probably null Het
Ckap5 A G 2: 91,548,940 Y75C probably damaging Het
Cndp1 A G 18: 84,622,258 M274T probably benign Het
Col24a1 G T 3: 145,474,238 G1162C probably damaging Het
Cr2 A T 1: 195,151,667 L938Q possibly damaging Het
Cubn G A 2: 13,424,727 T1321I probably benign Het
Cyp3a44 G A 5: 145,791,688 P242L probably damaging Het
Ddx4 A T 13: 112,601,507 D539E probably benign Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dgkd G T 1: 87,924,084 V403L probably damaging Het
Dnah2 T A 11: 69,520,834 M321L probably benign Het
Dpy19l1 A T 9: 24,422,338 M433K possibly damaging Het
Enoph1 A G 5: 100,061,133 K116E probably benign Het
Exd1 C A 2: 119,530,099 C174F probably damaging Het
Exoc7 A T 11: 116,297,682 probably null Het
Fam183b T C 11: 58,801,781 H40R possibly damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Farp2 G C 1: 93,567,515 probably null Het
Fbxo22 A T 9: 55,218,353 I167L probably benign Het
Fchsd2 A G 7: 101,250,542 N365S probably benign Het
Fgr T G 4: 132,986,521 probably null Het
Fkbp9 A G 6: 56,851,385 D194G probably damaging Het
Flnb T C 14: 7,933,800 S2152P possibly damaging Het
Flnc A G 6: 29,447,770 I1191V possibly damaging Het
Fpr-rs7 A T 17: 20,113,405 N274K probably benign Het
Fuca1 A G 4: 135,929,910 D211G probably damaging Het
Glb1l2 C T 9: 26,773,968 probably null Het
Gm13088 T C 4: 143,656,565 E28G probably damaging Het
Gm48552 T C 10: 81,390,992 *136R probably null Het
Hdgfl2 T C 17: 56,093,724 probably null Het
Icmt T G 4: 152,303,158 V270G probably damaging Het
Icosl A T 10: 78,073,740 D173V probably benign Het
Icosl G A 10: 78,073,952 V244I probably benign Het
Iqsec1 C T 6: 90,667,941 R903H probably damaging Het
Lrtm2 G A 6: 119,317,367 P268S possibly damaging Het
Methig1 T A 15: 100,353,370 L54Q probably benign Het
Mga T A 2: 119,919,678 L686H probably damaging Het
Mki67 A T 7: 135,695,204 S2700R probably benign Het
Muc16 T A 9: 18,659,318 D635V unknown Het
Muc4 G A 16: 32,751,321 V400I possibly damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Myh8 T C 11: 67,283,818 I253T probably damaging Het
Myo15b A T 11: 115,887,178 K852* probably null Het
Myo19 C T 11: 84,908,238 T799I possibly damaging Het
Naca T G 10: 128,043,049 S1317A unknown Het
Nipa1 T C 7: 55,979,810 Y185C probably damaging Het
Nlrc5 T A 8: 94,487,664 N910K probably damaging Het
Nucks1 G T 1: 131,910,736 M1I probably null Het
Nudt13 T C 14: 20,304,072 V68A probably benign Het
Oacyl A T 18: 65,725,383 M260L probably benign Het
Olfr106-ps C T 17: 37,395,442 L301F possibly damaging Het
Olfr524 A T 7: 140,202,299 I157N probably damaging Het
Olfr586 A T 7: 103,122,428 S115T probably damaging Het
Osbpl6 A G 2: 76,585,097 N601S probably damaging Het
Pcdh9 A G 14: 93,015,565 S1221P probably benign Het
Pcdhb16 T C 18: 37,478,245 L86P probably damaging Het
Pclo A C 5: 14,669,234 Q1128H unknown Het
Pcnx2 T A 8: 125,837,863 Y1097F probably benign Het
Per1 T A 11: 69,100,779 D46E probably damaging Het
Plce1 T A 19: 38,620,553 D435E probably benign Het
Prkaa1 C A 15: 5,177,151 Q461K probably damaging Het
Proc C T 18: 32,123,417 G399D probably damaging Het
Rbak G T 5: 143,174,262 S345R probably damaging Het
Rsph3b T C 17: 6,905,091 I325V probably benign Het
Sbf1 A T 15: 89,306,223 L323Q probably damaging Het
Scd3 G A 19: 44,235,892 R188H possibly damaging Het
Setdb1 T G 3: 95,326,399 N1067H possibly damaging Het
Spopl G A 2: 23,545,478 T15I probably benign Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stk39 A G 2: 68,307,039 probably null Het
Syt13 G T 2: 92,953,646 M420I probably damaging Het
Tas1r1 A T 4: 152,028,661 I645N possibly damaging Het
Tbx3 A T 5: 119,680,869 Q523L possibly damaging Het
Tbx3 G T 5: 119,680,870 Q523H probably benign Het
Tcf23 C T 5: 30,970,150 Q99* probably null Het
Tfip11 T A 5: 112,335,576 M619K probably benign Het
Tg A T 15: 66,683,793 H778L probably benign Het
Utp3 A G 5: 88,554,896 S95G probably benign Het
Zfp458 T A 13: 67,256,116 *753L probably null Het
Zfp9 T C 6: 118,465,071 Y210C possibly damaging Het
Other mutations in Col22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Col22a1 APN 15 71860958 critical splice donor site probably null
IGL00434:Col22a1 APN 15 72006675 missense possibly damaging 0.71
IGL00721:Col22a1 APN 15 71846177 missense unknown
IGL00902:Col22a1 APN 15 71964659 missense probably damaging 1.00
IGL01311:Col22a1 APN 15 71973637 splice site probably benign
IGL01329:Col22a1 APN 15 71907040 missense probably benign 0.02
IGL01527:Col22a1 APN 15 71907031 missense probably damaging 0.98
IGL01870:Col22a1 APN 15 71952528 missense probably benign 0.07
IGL02002:Col22a1 APN 15 71811097 splice site probably benign
IGL02248:Col22a1 APN 15 71799448 missense unknown
IGL02322:Col22a1 APN 15 71822653 missense unknown
IGL02472:Col22a1 APN 15 71827753 splice site probably benign
IGL02685:Col22a1 APN 15 71801915 missense unknown
IGL02888:Col22a1 APN 15 71846219 missense unknown
IGL02971:Col22a1 APN 15 72006738 missense probably damaging 1.00
IGL03175:Col22a1 APN 15 71969103 missense possibly damaging 0.81
IGL03240:Col22a1 APN 15 71807928 missense unknown
R0083:Col22a1 UTSW 15 71890497 missense possibly damaging 0.70
R0383:Col22a1 UTSW 15 71869004 missense unknown
R0449:Col22a1 UTSW 15 71962671 critical splice donor site probably null
R0508:Col22a1 UTSW 15 71933413 missense unknown
R0944:Col22a1 UTSW 15 71881662 missense probably benign 0.03
R1289:Col22a1 UTSW 15 71837377 missense unknown
R1436:Col22a1 UTSW 15 71922957 splice site probably benign
R1439:Col22a1 UTSW 15 71952377 splice site probably benign
R1460:Col22a1 UTSW 15 71821931 missense unknown
R1680:Col22a1 UTSW 15 71799361 missense unknown
R1715:Col22a1 UTSW 15 72006981 missense possibly damaging 0.79
R1742:Col22a1 UTSW 15 71801913 missense unknown
R1745:Col22a1 UTSW 15 72006787 missense probably damaging 1.00
R1763:Col22a1 UTSW 15 72007176 missense probably damaging 0.96
R1932:Col22a1 UTSW 15 71870140 missense unknown
R2125:Col22a1 UTSW 15 71848577 missense unknown
R2126:Col22a1 UTSW 15 71857253 nonsense probably null
R2137:Col22a1 UTSW 15 72006948 missense possibly damaging 0.46
R2860:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2861:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2862:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R3704:Col22a1 UTSW 15 71970307 missense probably damaging 1.00
R3778:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
R3940:Col22a1 UTSW 15 71981933 nonsense probably null
R3950:Col22a1 UTSW 15 71977358 missense possibly damaging 0.90
R4240:Col22a1 UTSW 15 72007131 missense probably damaging 1.00
R4531:Col22a1 UTSW 15 72007149 missense probably damaging 1.00
R4597:Col22a1 UTSW 15 71964662 missense possibly damaging 0.83
R4604:Col22a1 UTSW 15 71952339 missense probably benign 0.36
R4654:Col22a1 UTSW 15 71973695 missense possibly damaging 0.95
R4782:Col22a1 UTSW 15 71801925 missense unknown
R4847:Col22a1 UTSW 15 71799499 missense unknown
R4980:Col22a1 UTSW 15 71801943 missense unknown
R4981:Col22a1 UTSW 15 71861066 missense unknown
R4996:Col22a1 UTSW 15 72007161 missense probably damaging 0.99
R5007:Col22a1 UTSW 15 71944422 missense probably damaging 1.00
R5135:Col22a1 UTSW 15 71799337 missense unknown
R5197:Col22a1 UTSW 15 72009406 missense probably damaging 0.96
R5292:Col22a1 UTSW 15 71970336 missense probably damaging 1.00
R5449:Col22a1 UTSW 15 71821949 missense unknown
R5480:Col22a1 UTSW 15 71964611 missense probably damaging 0.98
R5627:Col22a1 UTSW 15 71981918 missense probably damaging 0.98
R5828:Col22a1 UTSW 15 72009491 missense probably benign 0.01
R5927:Col22a1 UTSW 15 72006966 missense probably damaging 1.00
R6006:Col22a1 UTSW 15 71973836 missense probably damaging 1.00
R6245:Col22a1 UTSW 15 71973816 missense probably damaging 0.99
R6288:Col22a1 UTSW 15 71894869 critical splice acceptor site probably null
R6482:Col22a1 UTSW 15 71890489 missense possibly damaging 0.93
R6497:Col22a1 UTSW 15 71890576 missense possibly damaging 0.85
R6579:Col22a1 UTSW 15 71881653 missense probably benign 0.18
R6643:Col22a1 UTSW 15 71822037 splice site probably null
R6663:Col22a1 UTSW 15 71820059 missense unknown
R7179:Col22a1 UTSW 15 71933413 missense unknown
R7215:Col22a1 UTSW 15 71970332 nonsense probably null
R7216:Col22a1 UTSW 15 71973845 missense probably damaging 1.00
R7505:Col22a1 UTSW 15 71799399 nonsense probably null
R7585:Col22a1 UTSW 15 71892205 missense probably damaging 0.99
R7699:Col22a1 UTSW 15 71973851 missense probably damaging 1.00
R7788:Col22a1 UTSW 15 71952317 critical splice donor site probably null
R8205:Col22a1 UTSW 15 71861069 missense unknown
R8769:Col22a1 UTSW 15 72006722 missense probably benign 0.21
R8780:Col22a1 UTSW 15 72006947 missense probably damaging 0.99
R8827:Col22a1 UTSW 15 71902816 critical splice donor site probably null
R8843:Col22a1 UTSW 15 72006654 missense probably damaging 1.00
R8982:Col22a1 UTSW 15 71973638 critical splice donor site probably null
R9031:Col22a1 UTSW 15 71881674 nonsense probably null
R9036:Col22a1 UTSW 15 71890582 missense probably damaging 1.00
R9084:Col22a1 UTSW 15 71820080 missense unknown
R9281:Col22a1 UTSW 15 71861071 missense unknown
R9386:Col22a1 UTSW 15 71981945 missense probably damaging 1.00
R9406:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
X0066:Col22a1 UTSW 15 71801879 missense unknown
X0066:Col22a1 UTSW 15 71846200 missense unknown
Y5406:Col22a1 UTSW 15 71799515 missense unknown
Z1177:Col22a1 UTSW 15 71915120 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGGCACCACGAAGTATGCTAC -3'
(R):5'- ACATGACTCATAGCTTGGCTG -3'

Sequencing Primer
(F):5'- ACGAAGTATGCTACCATTAGCTCAG -3'
(R):5'- GACTCATAGCTTGGCTGCTCTTG -3'
Posted On 2020-10-29