Mutagenetix > Incidental Mutation

Incidental Mutation 'R7988:Sclt1'

656386

Institutional Source

Beutler Lab

Gene Symbol

Sclt1

Ensembl Gene

ENSMUSG00000059834

Gene Name

sodium channel and clathrin linker 1

Synonyms

2610207F23Rik, 4931421F20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.167) question?

Stock #

R7988 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41626720-41742514 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to A at 41663454 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Leucine at position 29 (*29L)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026866] [ENSMUST00000146125] [ENSMUST00000148769]

AlphaFold

G5E861

Predicted Effect

probably benign
Transcript: ENSMUST00000026866

SMART Domains

Protein: ENSMUSP00000026866
Gene: ENSMUSG00000059834

Domain	Start	End	E-Value	Type
coiled coil region	59	105	N/A	INTRINSIC
internal_repeat_1	166	179	6.29e-5	PROSPERO
coiled coil region	372	543	N/A	INTRINSIC
internal_repeat_1	555	568	6.29e-5	PROSPERO
coiled coil region	571	675	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146125

Predicted Effect

probably benign
Transcript: ENSMUST00000148769

SMART Domains

Protein: ENSMUSP00000123392
Gene: ENSMUSG00000059834

Domain	Start	End	E-Value	Type
coiled coil region	59	105	N/A	INTRINSIC
coiled coil region	178	333	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000154773
AA Change: *29L

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein. Studies of a related gene in rat suggest that the encoded protein functions to link clathrin to the sodium channel protein type 10 subunit alpha protein. The encoded protein has also been identified as a component of distal appendages of centrioles that is necessary for ciliogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous knockout causes polycystic kidney disease, impaired postnatal weight gain and premature death (before 1 month of age). [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	C	T	6: 72,347,652	T56M	probably damaging	Het
2010111I01Rik	A	G	13: 63,061,140	D357G	probably benign	Het
4932415D10Rik	T	C	10: 82,296,100	I359V	probably benign	Het
Adamtsl5	C	T	10: 80,345,538	S36N	probably benign	Het
Adgrf5	A	T	17: 43,439,813		probably benign	Het
Ago1	A	G	4: 126,460,417	F200S	probably damaging	Het
Akr1cl	T	C	1: 65,024,706	D108G	possibly damaging	Het
Arhgef3	A	T	14: 27,401,786	D468V	probably benign	Het
Aspn	T	C	13: 49,551,877	C72R	possibly damaging	Het
Baz2b	T	C	2: 59,962,141	T548A	possibly damaging	Het
Birc6	G	A	17: 74,599,373		probably null	Het
Btnl2	A	T	17: 34,358,275	T135S	possibly damaging	Het
Ccnl1	T	A	3: 65,957,861	I90F	possibly damaging	Het
Ccnt1	T	C	15: 98,565,143		probably null	Het
Cemip	C	A	7: 84,003,408		probably benign	Het
Cfap45	A	G	1: 172,529,934	D85G	probably damaging	Het
Cfap54	T	A	10: 92,902,079	D2319V	unknown	Het
Cma1	T	C	14: 55,944,532	M14V	possibly damaging	Het
Cmtm1	T	C	8: 104,310,142		probably benign	Het
Col27a1	A	G	4: 63,331,322	H1738R	unknown	Het
Colq	T	A	14: 31,553,837	D41V	probably damaging	Het
Cubn	T	C	2: 13,332,355	T2437A	probably benign	Het
Dnah14	A	G	1: 181,783,574	D3755G	probably damaging	Het
Eprs	A	G	1: 185,418,348	Y1349C	probably damaging	Het
Eps8	C	T	6: 137,528,571	R53Q	possibly damaging	Het
Fam196a	T	G	7: 134,917,698	K368Q	probably damaging	Het
Fbf1	T	C	11: 116,152,768	D405G	probably benign	Het
Fen1	C	T	19: 10,200,310	E257K	possibly damaging	Het
Gstm7	A	T	3: 107,926,955	M198K	possibly damaging	Het
Hook3	A	T	8: 26,073,647	S190T	probably benign	Het
Htra4	A	C	8: 25,030,510		probably null	Het
Ighv1-15	T	C	12: 114,657,496	I70V	probably benign	Het
Ikzf4	T	A	10: 128,634,455	N452Y	probably damaging	Het
Iqcf5	T	A	9: 106,515,821	N92K	possibly damaging	Het
Itk	A	G	11: 46,355,834	Y186H	probably damaging	Het
Klhdc10	T	C	6: 30,446,691	S282P	probably benign	Het
Klhl18	T	A	9: 110,476,509	E29V	possibly damaging	Het
Ky	T	C	9: 102,525,415	S140P	probably damaging	Het
Lmntd2	T	C	7: 141,213,637	E112G	unknown	Het
Lrrc36	C	A	8: 105,452,086	D304E	possibly damaging	Het
Macf1	A	T	4: 123,506,480	F674Y	probably damaging	Het
Notch1	C	T	2: 26,471,001	D1111N	probably benign	Het
Osbpl8	T	G	10: 111,272,080	N312K	possibly damaging	Het
Otogl	C	T	10: 107,895,776	C168Y	probably damaging	Het
Phldb2	T	G	16: 45,825,571	T171P	probably benign	Het
Ppef2	A	T	5: 92,238,982	F365L	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Ryr1	G	A	7: 29,096,171	T1105I	probably benign	Het
Scn11a	T	C	9: 119,765,437	K1297E	probably damaging	Het
Serpinb9c	T	A	13: 33,150,279	Y288F	probably benign	Het
Setd1a	T	A	7: 127,786,194	M691K	probably benign	Het
Sftpc	T	C	14: 70,522,619	E66G	probably damaging	Het
Thnsl2	T	C	6: 71,141,319	T42A	probably benign	Het
Tram1	T	C	1: 13,569,975	D285G	probably benign	Het
Ttn	A	T	2: 76,736,240	I28103K	probably damaging	Het
Ttn	G	A	2: 76,845,030	P11137L	unknown	Het
Ttn	C	A	2: 76,896,759	V5821F	unknown	Het
Usp38	T	A	8: 81,014,316	M41L	probably benign	Het
Zcwpw1	T	G	5: 137,817,491	Y419D	possibly damaging	Het
Zfp407	G	A	18: 84,559,400	A1196V	possibly damaging	Het
Zfp446	T	A	7: 12,979,043	S103T	possibly damaging	Het

Other mutations in Sclt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Sclt1	APN	3	41741991	unclassified	probably benign
IGL01106:Sclt1	APN	3	41675319	splice site	probably benign
IGL01368:Sclt1	APN	3	41711175	missense	probably damaging	0.96
IGL02001:Sclt1	APN	3	41681721	missense	possibly damaging	0.63
IGL02897:Sclt1	APN	3	41675387	missense	probably benign	0.01
IGL03066:Sclt1	APN	3	41717843	missense	probably benign	0.00
R0038:Sclt1	UTSW	3	41629508	splice site	probably benign
R0038:Sclt1	UTSW	3	41629508	splice site	probably benign
R0172:Sclt1	UTSW	3	41717787	missense	possibly damaging	0.84
R0359:Sclt1	UTSW	3	41661570	critical splice donor site	probably null
R1281:Sclt1	UTSW	3	41647620	missense	probably benign	0.01
R1831:Sclt1	UTSW	3	41727111	missense	probably damaging	0.99
R1832:Sclt1	UTSW	3	41727111	missense	probably damaging	0.99
R1833:Sclt1	UTSW	3	41727111	missense	probably damaging	0.99
R2027:Sclt1	UTSW	3	41730888	missense	probably benign	0.00
R4578:Sclt1	UTSW	3	41671465	nonsense	probably null
R5502:Sclt1	UTSW	3	41657275	missense	probably benign	0.28
R5558:Sclt1	UTSW	3	41661590	missense	probably benign	0.14
R5601:Sclt1	UTSW	3	41730919	missense	probably benign
R5710:Sclt1	UTSW	3	41663963	nonsense	probably null
R6041:Sclt1	UTSW	3	41627177	missense	probably damaging	0.99
R6274:Sclt1	UTSW	3	41629516	critical splice donor site	probably null
R6765:Sclt1	UTSW	3	41730902	missense	unknown
R7171:Sclt1	UTSW	3	41717760	missense	probably benign	0.00
R7489:Sclt1	UTSW	3	41629597	missense	probably damaging	0.99
R8040:Sclt1	UTSW	3	41657376	missense	probably damaging	1.00
R8158:Sclt1	UTSW	3	41671482	missense	probably benign	0.36
R8383:Sclt1	UTSW	3	41742015	missense	probably benign	0.13
R8956:Sclt1	UTSW	3	41681774	missense	probably benign	0.01
R8971:Sclt1	UTSW	3	41727106	missense	probably benign	0.01
R9227:Sclt1	UTSW	3	41711196	missense	probably benign	0.01
R9230:Sclt1	UTSW	3	41711196	missense	probably benign	0.01
R9463:Sclt1	UTSW	3	41647496	missense	probably damaging	1.00
R9729:Sclt1	UTSW	3	41675402	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGCACTTTAAACATGGTAAGTGC -3'
(R):5'- TGGTGGTAATAGGTATAGACAACC -3'

Sequencing Primer
(F):5'- AACTGAACACAGGTCTCTGG -3'
(R):5'- GCATAGAGACCAGAGGTTG -3'

Posted On

2020-11-02