Incidental Mutation 'R7988:Ccnt1'
ID 656387
Institutional Source Beutler Lab
Gene Symbol Ccnt1
Ensembl Gene ENSMUSG00000011960
Gene Name cyclin T1
Synonyms 2810478G24Rik, CycT1
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.911) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 98436570-98468340 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 98463024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012104] [ENSMUST00000168928] [ENSMUST00000169707]
AlphaFold Q9QWV9
Predicted Effect probably null
Transcript: ENSMUST00000012104
SMART Domains Protein: ENSMUSP00000012104
Gene: ENSMUSG00000011960

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
SCOP:d1jkw_2 152 257 1e-24 SMART
Blast:CYCLIN 155 243 2e-54 BLAST
low complexity region 308 326 N/A INTRINSIC
coiled coil region 388 419 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
low complexity region 706 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168928
SMART Domains Protein: ENSMUSP00000130286
Gene: ENSMUSG00000011960

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
Blast:CYCLIN 155 182 3e-9 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000169707
SMART Domains Protein: ENSMUSP00000126874
Gene: ENSMUSG00000011960

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
SCOP:d1jkw_2 152 257 1e-24 SMART
Blast:CYCLIN 155 243 2e-54 BLAST
low complexity region 308 326 N/A INTRINSIC
coiled coil region 388 419 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
low complexity region 706 723 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the highly conserved cyclin C subfamily. The encoded protein tightly associates with cyclin-dependent kinase 9, and is a major subunit of positive transcription elongation factor b (p-TEFb). In humans, there are multiple forms of positive transcription elongation factor b, which may include one of several different cyclins along with cyclin-dependent kinase 9. The complex containing the encoded cyclin and cyclin-dependent kinase 9 acts as a cofactor of human immunodeficiency virus type 1 (HIV-1) Tat protein, and is both necessary and sufficient for full activation of viral transcription. This cyclin and its kinase partner are also involved in triggering transcript elongation through phosphorylation of the carboxy-terminal domain of the largest RNA polymerase II subunit. Overexpression of this gene is implicated in tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Ago1 A G 4: 126,354,210 (GRCm39) F200S probably damaging Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Arhgef3 A T 14: 27,123,743 (GRCm39) D468V probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Col27a1 A G 4: 63,249,559 (GRCm39) H1738R unknown Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Cubn T C 2: 13,337,166 (GRCm39) T2437A probably benign Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Fen1 C T 19: 10,177,674 (GRCm39) E257K possibly damaging Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Hook3 A T 8: 26,563,675 (GRCm39) S190T probably benign Het
Htra4 A C 8: 25,520,526 (GRCm39) probably null Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lmntd2 T C 7: 140,793,550 (GRCm39) E112G unknown Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Osbpl8 T G 10: 111,107,941 (GRCm39) N312K possibly damaging Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Phldb2 T G 16: 45,645,934 (GRCm39) T171P probably benign Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Ccnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ccnt1 APN 15 98,462,990 (GRCm39) missense possibly damaging 0.75
IGL00900:Ccnt1 APN 15 98,452,514 (GRCm39) missense probably damaging 1.00
IGL01798:Ccnt1 APN 15 98,442,122 (GRCm39) missense probably benign 0.00
IGL02126:Ccnt1 APN 15 98,465,484 (GRCm39) missense probably damaging 1.00
IGL02341:Ccnt1 APN 15 98,444,664 (GRCm39) missense possibly damaging 0.92
Lifecycle UTSW 15 98,463,005 (GRCm39) nonsense probably null
R0049:Ccnt1 UTSW 15 98,462,960 (GRCm39) missense probably benign 0.05
R0049:Ccnt1 UTSW 15 98,462,960 (GRCm39) missense probably benign 0.05
R1116:Ccnt1 UTSW 15 98,442,219 (GRCm39) missense probably damaging 1.00
R2063:Ccnt1 UTSW 15 98,449,823 (GRCm39) missense probably benign 0.25
R2065:Ccnt1 UTSW 15 98,449,823 (GRCm39) missense probably benign 0.25
R2066:Ccnt1 UTSW 15 98,449,823 (GRCm39) missense probably benign 0.25
R2068:Ccnt1 UTSW 15 98,449,823 (GRCm39) missense probably benign 0.25
R2180:Ccnt1 UTSW 15 98,441,481 (GRCm39) missense possibly damaging 0.74
R3917:Ccnt1 UTSW 15 98,441,940 (GRCm39) missense probably benign 0.00
R4805:Ccnt1 UTSW 15 98,442,189 (GRCm39) missense probably benign 0.00
R4830:Ccnt1 UTSW 15 98,441,332 (GRCm39) missense probably damaging 1.00
R4836:Ccnt1 UTSW 15 98,465,444 (GRCm39) missense probably damaging 0.96
R5320:Ccnt1 UTSW 15 98,442,124 (GRCm39) missense probably benign 0.35
R5740:Ccnt1 UTSW 15 98,442,381 (GRCm39) missense probably benign 0.01
R5870:Ccnt1 UTSW 15 98,441,394 (GRCm39) nonsense probably null
R6074:Ccnt1 UTSW 15 98,441,205 (GRCm39) missense probably damaging 1.00
R6413:Ccnt1 UTSW 15 98,441,850 (GRCm39) missense probably benign 0.01
R6610:Ccnt1 UTSW 15 98,462,982 (GRCm39) missense probably damaging 1.00
R7260:Ccnt1 UTSW 15 98,463,005 (GRCm39) nonsense probably null
R7752:Ccnt1 UTSW 15 98,441,797 (GRCm39) missense probably benign 0.00
R7901:Ccnt1 UTSW 15 98,441,797 (GRCm39) missense probably benign 0.00
R8699:Ccnt1 UTSW 15 98,462,995 (GRCm39) missense probably damaging 0.98
R8959:Ccnt1 UTSW 15 98,441,096 (GRCm39) utr 3 prime probably benign
R9143:Ccnt1 UTSW 15 98,441,688 (GRCm39) missense probably damaging 1.00
R9153:Ccnt1 UTSW 15 98,441,159 (GRCm39) missense probably benign 0.28
R9331:Ccnt1 UTSW 15 98,441,097 (GRCm39) nonsense probably null
R9549:Ccnt1 UTSW 15 98,441,574 (GRCm39) missense probably damaging 0.99
R9684:Ccnt1 UTSW 15 98,446,566 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACATTTGTCTTCTTACTCGGAAAGC -3'
(R):5'- GGATCGTCTTTGCAGAAGGC -3'

Sequencing Primer
(F):5'- TCATAGTTCAATAACAACGACCAATC -3'
(R):5'- AAGCCTGAGGTCGTATGCAGC -3'
Posted On 2020-11-02