Mutagenetix > Incidental Mutation

Incidental Mutation 'R7988:Adgrf5'

656388

Institutional Source

Beutler Lab

Gene Symbol

Adgrf5

Ensembl Gene

ENSMUSG00000056492

Gene Name

adhesion G protein-coupled receptor F5

Synonyms

Gpr116, 8430401C09Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7988 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43360451-43459557 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 43439813 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113599] [ENSMUST00000225004] [ENSMUST00000225962] [ENSMUST00000226087]

AlphaFold

G5E8Q8

Predicted Effect

probably benign
Transcript: ENSMUST00000113599

SMART Domains

Protein: ENSMUSP00000109229
Gene: ENSMUSG00000056492

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Blast:EGF	118	161	8e-14	BLAST
Pfam:SEA	165	263	9.2e-14	PFAM
IG	276	366	1.54e-4	SMART
Blast:IG_like	374	464	2e-31	BLAST
IG	475	561	1.04e-1	SMART
low complexity region	815	823	N/A	INTRINSIC
GPS	949	1004	6.49e-16	SMART
Pfam:7tm_2	1011	1264	1.2e-35	PFAM
low complexity region	1328	1347	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000225004
AA Change: T129S

Predicted Effect

probably benign
Transcript: ENSMUST00000225962

Predicted Effect

probably benign
Transcript: ENSMUST00000226087

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased body weight and respiratory distress associated with pulmonary alveolar proteinosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	C	T	6: 72,347,652	T56M	probably damaging	Het
2010111I01Rik	A	G	13: 63,061,140	D357G	probably benign	Het
4932415D10Rik	T	C	10: 82,296,100	I359V	probably benign	Het
Adamtsl5	C	T	10: 80,345,538	S36N	probably benign	Het
Ago1	A	G	4: 126,460,417	F200S	probably damaging	Het
Akr1cl	T	C	1: 65,024,706	D108G	possibly damaging	Het
Arhgef3	A	T	14: 27,401,786	D468V	probably benign	Het
Aspn	T	C	13: 49,551,877	C72R	possibly damaging	Het
Baz2b	T	C	2: 59,962,141	T548A	possibly damaging	Het
Birc6	G	A	17: 74,599,373		probably null	Het
Btnl2	A	T	17: 34,358,275	T135S	possibly damaging	Het
Ccnl1	T	A	3: 65,957,861	I90F	possibly damaging	Het
Ccnt1	T	C	15: 98,565,143		probably null	Het
Cemip	C	A	7: 84,003,408		probably benign	Het
Cfap45	A	G	1: 172,529,934	D85G	probably damaging	Het
Cfap54	T	A	10: 92,902,079	D2319V	unknown	Het
Cma1	T	C	14: 55,944,532	M14V	possibly damaging	Het
Cmtm1	T	C	8: 104,310,142		probably benign	Het
Col27a1	A	G	4: 63,331,322	H1738R	unknown	Het
Colq	T	A	14: 31,553,837	D41V	probably damaging	Het
Cubn	T	C	2: 13,332,355	T2437A	probably benign	Het
Dnah14	A	G	1: 181,783,574	D3755G	probably damaging	Het
Eprs	A	G	1: 185,418,348	Y1349C	probably damaging	Het
Eps8	C	T	6: 137,528,571	R53Q	possibly damaging	Het
Fam196a	T	G	7: 134,917,698	K368Q	probably damaging	Het
Fbf1	T	C	11: 116,152,768	D405G	probably benign	Het
Fen1	C	T	19: 10,200,310	E257K	possibly damaging	Het
Gstm7	A	T	3: 107,926,955	M198K	possibly damaging	Het
Hook3	A	T	8: 26,073,647	S190T	probably benign	Het
Htra4	A	C	8: 25,030,510		probably null	Het
Ighv1-15	T	C	12: 114,657,496	I70V	probably benign	Het
Ikzf4	T	A	10: 128,634,455	N452Y	probably damaging	Het
Iqcf5	T	A	9: 106,515,821	N92K	possibly damaging	Het
Itk	A	G	11: 46,355,834	Y186H	probably damaging	Het
Klhdc10	T	C	6: 30,446,691	S282P	probably benign	Het
Klhl18	T	A	9: 110,476,509	E29V	possibly damaging	Het
Ky	T	C	9: 102,525,415	S140P	probably damaging	Het
Lmntd2	T	C	7: 141,213,637	E112G	unknown	Het
Lrrc36	C	A	8: 105,452,086	D304E	possibly damaging	Het
Macf1	A	T	4: 123,506,480	F674Y	probably damaging	Het
Notch1	C	T	2: 26,471,001	D1111N	probably benign	Het
Osbpl8	T	G	10: 111,272,080	N312K	possibly damaging	Het
Otogl	C	T	10: 107,895,776	C168Y	probably damaging	Het
Phldb2	T	G	16: 45,825,571	T171P	probably benign	Het
Ppef2	A	T	5: 92,238,982	F365L	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Ryr1	G	A	7: 29,096,171	T1105I	probably benign	Het
Sclt1	T	A	3: 41,663,454	*29L	probably null	Het
Scn11a	T	C	9: 119,765,437	K1297E	probably damaging	Het
Serpinb9c	T	A	13: 33,150,279	Y288F	probably benign	Het
Setd1a	T	A	7: 127,786,194	M691K	probably benign	Het
Sftpc	T	C	14: 70,522,619	E66G	probably damaging	Het
Thnsl2	T	C	6: 71,141,319	T42A	probably benign	Het
Tram1	T	C	1: 13,569,975	D285G	probably benign	Het
Ttn	A	T	2: 76,736,240	I28103K	probably damaging	Het
Ttn	G	A	2: 76,845,030	P11137L	unknown	Het
Ttn	C	A	2: 76,896,759	V5821F	unknown	Het
Usp38	T	A	8: 81,014,316	M41L	probably benign	Het
Zcwpw1	T	G	5: 137,817,491	Y419D	possibly damaging	Het
Zfp407	G	A	18: 84,559,400	A1196V	possibly damaging	Het
Zfp446	T	A	7: 12,979,043	S103T	possibly damaging	Het

Other mutations in Adgrf5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Adgrf5	APN	17	43449915	missense	possibly damaging	0.79
IGL00590:Adgrf5	APN	17	43453147	missense	probably damaging	1.00
IGL01128:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01131:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01132:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01392:Adgrf5	APN	17	43450012	missense	probably benign	0.00
IGL01475:Adgrf5	APN	17	43450354	missense	probably benign	0.00
IGL01614:Adgrf5	APN	17	43424471	missense	possibly damaging	0.53
IGL01654:Adgrf5	APN	17	43451170	missense	possibly damaging	0.89
IGL02053:Adgrf5	APN	17	43450167	missense	possibly damaging	0.47
IGL02175:Adgrf5	APN	17	43451010	missense	probably damaging	1.00
IGL02416:Adgrf5	APN	17	43444980	splice site	probably null
IGL02525:Adgrf5	APN	17	43449963	missense	probably damaging	1.00
IGL03035:Adgrf5	APN	17	43430627	missense	possibly damaging	0.80
duct_tape	UTSW	17	43445115	missense	probably benign	0.04
Flypaper	UTSW	17	43422661	splice site	probably benign
goop	UTSW	17	43441969	missense	probably damaging	0.99
Heaped	UTSW	17	43447036	missense	possibly damaging	0.93
la_brea	UTSW	17	43452323	critical splice donor site	probably null
Motel	UTSW	17	43450380	missense	probably damaging	1.00
noel	UTSW	17	43430612	missense	probably damaging	1.00
Schmutzfinger	UTSW	17	43424818	nonsense	probably null
sticky	UTSW	17	43437571	missense	probably damaging	0.98
sweetie	UTSW	17	43450983	missense	probably damaging	0.96
PIT4812001:Adgrf5	UTSW	17	43450369	missense	probably damaging	1.00
R0699:Adgrf5	UTSW	17	43422661	splice site	probably null
R0972:Adgrf5	UTSW	17	43450983	missense	probably damaging	0.96
R1521:Adgrf5	UTSW	17	43430552	missense	probably benign	0.03
R1523:Adgrf5	UTSW	17	43450153	missense	probably benign	0.00
R1758:Adgrf5	UTSW	17	43424593	critical splice donor site	probably null
R1767:Adgrf5	UTSW	17	43450564	missense	possibly damaging	0.87
R1799:Adgrf5	UTSW	17	43440067	missense	probably damaging	0.98
R1800:Adgrf5	UTSW	17	43451082	missense	probably damaging	1.00
R1888:Adgrf5	UTSW	17	43427005	splice site	probably null
R1888:Adgrf5	UTSW	17	43427005	splice site	probably null
R2057:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2058:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2059:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2410:Adgrf5	UTSW	17	43455266	missense	probably benign	0.11
R2568:Adgrf5	UTSW	17	43437671	missense	probably damaging	1.00
R2847:Adgrf5	UTSW	17	43422640	missense	possibly damaging	0.69
R2848:Adgrf5	UTSW	17	43422640	missense	possibly damaging	0.69
R3800:Adgrf5	UTSW	17	43447060	splice site	probably benign
R3856:Adgrf5	UTSW	17	43447036	missense	possibly damaging	0.93
R4021:Adgrf5	UTSW	17	43430714	splice site	probably benign
R4075:Adgrf5	UTSW	17	43450195	missense	probably damaging	1.00
R4366:Adgrf5	UTSW	17	43441969	missense	probably damaging	0.99
R4409:Adgrf5	UTSW	17	43441847	missense	probably damaging	1.00
R4570:Adgrf5	UTSW	17	43445115	missense	probably benign	0.04
R4616:Adgrf5	UTSW	17	43452440	missense	probably benign	0.38
R4623:Adgrf5	UTSW	17	43450983	missense	probably benign	0.16
R4645:Adgrf5	UTSW	17	43437525	missense	probably damaging	1.00
R5211:Adgrf5	UTSW	17	43422620	missense	probably benign	0.32
R5268:Adgrf5	UTSW	17	43450999	missense	probably damaging	1.00
R5280:Adgrf5	UTSW	17	43426334	missense	probably damaging	1.00
R5326:Adgrf5	UTSW	17	43440074	missense	probably damaging	0.98
R5762:Adgrf5	UTSW	17	43430695	missense	probably null	0.16
R5856:Adgrf5	UTSW	17	43446120	missense	probably benign	0.09
R6007:Adgrf5	UTSW	17	43437571	missense	probably damaging	0.98
R6153:Adgrf5	UTSW	17	43451083	missense	possibly damaging	0.96
R6451:Adgrf5	UTSW	17	43424818	nonsense	probably null
R6535:Adgrf5	UTSW	17	43440029	missense	probably benign	0.05
R6536:Adgrf5	UTSW	17	43422661	splice site	probably benign
R6602:Adgrf5	UTSW	17	43450304	missense	probably benign	0.32
R6882:Adgrf5	UTSW	17	43450380	missense	probably damaging	1.00
R6992:Adgrf5	UTSW	17	43452323	critical splice donor site	probably null
R7137:Adgrf5	UTSW	17	43450897	missense	probably damaging	1.00
R7170:Adgrf5	UTSW	17	43446138	missense	possibly damaging	0.92
R7313:Adgrf5	UTSW	17	43445083	missense	probably benign	0.01
R7313:Adgrf5	UTSW	17	43452477	critical splice donor site	probably null
R7331:Adgrf5	UTSW	17	43437593	missense	probably damaging	0.99
R7346:Adgrf5	UTSW	17	43451179	missense	probably damaging	1.00
R7350:Adgrf5	UTSW	17	43428444	critical splice acceptor site	probably null
R7667:Adgrf5	UTSW	17	43446039	missense	probably benign	0.01
R7717:Adgrf5	UTSW	17	43450753	missense	probably damaging	1.00
R7731:Adgrf5	UTSW	17	43450560	missense	probably damaging	1.00
R7877:Adgrf5	UTSW	17	43441838	missense	possibly damaging	0.63
R7950:Adgrf5	UTSW	17	43451157	missense	probably damaging	0.99
R8188:Adgrf5	UTSW	17	43430612	missense	probably damaging	1.00
R8219:Adgrf5	UTSW	17	43449859	missense	probably benign	0.13
R8284:Adgrf5	UTSW	17	43455270	missense	unknown
R8460:Adgrf5	UTSW	17	43439808	intron	probably benign
R8504:Adgrf5	UTSW	17	43446949	missense	probably benign	0.01
R8751:Adgrf5	UTSW	17	43437683	missense	possibly damaging	0.80
R8852:Adgrf5	UTSW	17	43453098	missense	possibly damaging	0.82
R9196:Adgrf5	UTSW	17	43445104	missense	possibly damaging	0.94
R9418:Adgrf5	UTSW	17	43426973	missense	probably benign	0.00
R9671:Adgrf5	UTSW	17	43449904	missense	probably damaging	1.00
R9734:Adgrf5	UTSW	17	43452308	missense	probably damaging	1.00
R9756:Adgrf5	UTSW	17	43450246	missense	probably benign	0.01
R9765:Adgrf5	UTSW	17	43437600	missense	probably damaging	1.00
X0017:Adgrf5	UTSW	17	43427045	missense	probably damaging	1.00
Z1177:Adgrf5	UTSW	17	43445053	missense	probably benign	0.00
Z1191:Adgrf5	UTSW	17	43445035	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- ATCCCTAAGTGTGCAACCTTC -3'
(R):5'- AAAGCTACTCACATCGCTGAGG -3'

Sequencing Primer
(F):5'- AAGTGTGCAACCTTCTACCCTG -3'
(R):5'- GGCAGGTTATAGAAAAGCTTTGTCCC -3'

Posted On

2020-11-02