Mutagenetix > Incidental Mutations

Incidental Mutation 'R7973:Syt2'

656390

Institutional Source

Beutler Lab

Gene Symbol

Syt2

Ensembl Gene

ENSMUSG00000026452

Gene Name

synaptotagmin II

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R7973 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

134646677-134762593 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to A at 134740832 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121990] [ENSMUST00000187725] [ENSMUST00000188842]

Predicted Effect

probably null
Transcript: ENSMUST00000121990

SMART Domains

Protein: ENSMUSP00000112438
Gene: ENSMUSG00000026452

Domain	Start	End	E-Value	Type
PDB:4KBB\|D	5	63	7e-16	PDB
transmembrane domain	65	87	N/A	INTRINSIC
low complexity region	124	145	N/A	INTRINSIC
C2	158	260	7.21e-22	SMART
C2	289	403	1.86e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000187725

SMART Domains

Protein: ENSMUSP00000141156
Gene: ENSMUSG00000026452

Domain	Start	End	E-Value	Type
PDB:4KBB\|D	5	63	5e-18	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000188842

SMART Domains

Protein: ENSMUSP00000140081
Gene: ENSMUSG00000026452

Domain	Start	End	E-Value	Type
PDB:4KBB\|D	5	63	7e-16	PDB
transmembrane domain	65	87	N/A	INTRINSIC
low complexity region	124	145	N/A	INTRINSIC
C2	158	260	7.21e-22	SMART
C2	289	403	1.86e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in this gene are associated with myasthenic syndrome, presynaptic, congenital, with or without motor neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele are viable but sterile, weigh less and show ataxia and altered spontaneous and Ca2+-evoked neurotransmitter release. Mice homozygous for a null allele die at weaning showing growth arrest, motor dysfunction and impaired Ca2+-evoked neurotransmitter release. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016L21Rik	A	G	5: 114,946,053	D76G	probably benign	Het
Abcg1	T	C	17: 31,104,158	V237A	probably damaging	Het
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Akap11	A	T	14: 78,515,066	H122Q		Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
Arhgef4	C	T	1: 34,724,437	R925W	possibly damaging	Het
Arid1a	C	T	4: 133,753,070	G181D	probably damaging	Het
Ash1l	T	A	3: 89,052,857	S2299T	probably benign	Het
Atf7ip	C	T	6: 136,561,064	Q432*	probably null	Het
B430306N03Rik	T	A	17: 48,316,455	S10T	probably benign	Het
Bckdk	A	G	7: 127,906,367	I221V	probably benign	Het
Brinp2	T	C	1: 158,246,487	Y688C	probably damaging	Het
Caml	C	T	13: 55,631,971	L286F	probably benign	Het
Ccdc125	C	T	13: 100,669,823		probably benign	Het
Cdh24	A	T	14: 54,639,020	V116E	possibly damaging	Het
Cenpe	T	A	3: 135,223,250	I305N	probably damaging	Het
Cep41	C	T	6: 30,680,131	G33S	probably damaging	Het
Clec4b2	A	T	6: 123,204,189	I178L	probably benign	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Dapk1	T	A	13: 60,761,563	L1330Q	probably damaging	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
Fmnl1	G	T	11: 103,171,158		probably benign	Het
Galk1	A	G	11: 116,012,609	F24L	possibly damaging	Het
Hyal4	T	A	6: 24,755,786	M1K	probably null	Het
Ighe	T	C	12: 113,273,057	T64A		Het
Iqch	A	G	9: 63,524,946	I389T	possibly damaging	Het
Ism2	G	T	12: 87,286,995	T92K	possibly damaging	Het
Kctd17	CAGCTGGAGGAGC	CAGC	15: 78,436,913		probably benign	Het
Kdm1b	T	C	13: 47,077,446	S650P	probably benign	Het
Mapkapk5	T	G	5: 121,525,713	N426T	possibly damaging	Het
Mroh5	G	T	15: 73,792,765	Y90*	probably null	Het
Ncan	T	G	8: 70,097,575	I1184L	probably benign	Het
Nectin3	T	C	16: 46,396,121	T439A	probably benign	Het
Neo1	G	T	9: 58,990,193	A160E	probably damaging	Het
Nosip	T	C	7: 45,077,360	S295P	possibly damaging	Het
Nup205	T	A	6: 35,245,339	F1979L	probably benign	Het
Nxpe2	A	T	9: 48,319,868	D400E	probably damaging	Het
Olfr1246	T	A	2: 89,590,987	I43F	probably damaging	Het
Pfkfb4	G	A	9: 109,025,111	R351Q	probably damaging	Het
Psg29	T	C	7: 17,210,537	I324T	probably benign	Het
Ptprh	G	T	7: 4,580,888	T235N	possibly damaging	Het
Ralgapa2	T	A	2: 146,388,561	N981I	possibly damaging	Het
Ralgps1	T	C	2: 33,146,639	Y421C	probably damaging	Het
Sf3b3	T	C	8: 110,816,290	E845G	possibly damaging	Het
Sgk1	G	T	10: 21,994,155	S31I	probably benign	Het
Sim1	T	G	10: 50,981,323	Y390D	probably damaging	Het
Slain2	T	A	5: 72,955,436	Y271*	probably null	Het
Slc12a4	G	A	8: 105,951,605	R319W	possibly damaging	Het
St6gal1	G	A	16: 23,357,835	A393T	probably benign	Het
Stab1	A	T	14: 31,159,633		probably null	Het
Supv3l1	A	T	10: 62,449,423	L88Q	probably damaging	Het
Tpr	C	T	1: 150,403,887	R256C	probably damaging	Het
Tubg1	G	T	11: 101,124,028	A199S	probably benign	Het
Usp32	A	G	11: 85,022,808	I899T	probably damaging	Het
Usp6nl	G	T	2: 6,408,951	R96M	probably damaging	Het
Vmn1r75	A	G	7: 11,881,034	D231G	probably benign	Het
Vmn2r42	T	C	7: 8,194,873	E249G	probably benign	Het
Zbtb34	C	T	2: 33,411,519	G337R	probably benign	Het
Zfp457	T	A	13: 67,293,818	H231L	probably benign	Het
Zfp715	C	T	7: 43,299,897	G213D	possibly damaging	Het
Zfp760	T	G	17: 21,722,103	H86Q	probably benign	Het

Other mutations in Syt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02385:Syt2	APN	1	134745815	missense	probably benign	0.07
IGL02476:Syt2	APN	1	134747631	missense	probably benign	0.01
IGL02487:Syt2	APN	1	134740865	missense	probably damaging	0.99
IGL02524:Syt2	APN	1	134741965	missense	probably benign
IGL02611:Syt2	APN	1	134741882	missense	possibly damaging	0.90
IGL03173:Syt2	APN	1	134743579	missense	possibly damaging	0.81
IGL03303:Syt2	APN	1	134741911	missense	probably benign	0.44
kringle	UTSW	1	134747620	missense	probably damaging	1.00
R1661:Syt2	UTSW	1	134747620	missense	probably damaging	1.00
R1665:Syt2	UTSW	1	134747620	missense	probably damaging	1.00
R2049:Syt2	UTSW	1	134746741	splice site	probably benign
R2130:Syt2	UTSW	1	134746741	splice site	probably benign
R2141:Syt2	UTSW	1	134746741	splice site	probably benign
R3154:Syt2	UTSW	1	134741861	missense	possibly damaging	0.95
R5392:Syt2	UTSW	1	134744021	missense	probably damaging	1.00
R5431:Syt2	UTSW	1	134740957	missense	probably benign	0.03
R6065:Syt2	UTSW	1	134747557	missense	probably benign	0.00
R6381:Syt2	UTSW	1	134746850	missense	probably damaging	1.00
R6816:Syt2	UTSW	1	134745800	missense	probably damaging	1.00
R6923:Syt2	UTSW	1	134746763	missense	possibly damaging	0.76
R7002:Syt2	UTSW	1	134744104	missense	probably damaging	1.00
R7994:Syt2	UTSW	1	134747592	missense	possibly damaging	0.75
R8410:Syt2	UTSW	1	134746864	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- ACAGAAGGGCAGATGCATTC -3'
(R):5'- CTTCAGCTTGGCGAACATG -3'

Sequencing Primer
(F):5'- AGCTGTCTTCAGACGCTTCAGAAG -3'
(R):5'- AGCTTGGCGAACATGTCTTC -3'

Posted On

2020-11-02