Incidental Mutation 'R7973:Syt2'
ID656390
Institutional Source Beutler Lab
Gene Symbol Syt2
Ensembl Gene ENSMUSG00000026452
Gene Namesynaptotagmin II
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7973 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location134646677-134762593 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 134740832 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121990] [ENSMUST00000187725] [ENSMUST00000188842]
Predicted Effect probably null
Transcript: ENSMUST00000121990
SMART Domains Protein: ENSMUSP00000112438
Gene: ENSMUSG00000026452

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187725
SMART Domains Protein: ENSMUSP00000141156
Gene: ENSMUSG00000026452

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 5e-18 PDB
Predicted Effect probably null
Transcript: ENSMUST00000188842
SMART Domains Protein: ENSMUSP00000140081
Gene: ENSMUSG00000026452

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in this gene are associated with myasthenic syndrome, presynaptic, congenital, with or without motor neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele are viable but sterile, weigh less and show ataxia and altered spontaneous and Ca2+-evoked neurotransmitter release. Mice homozygous for a null allele die at weaning showing growth arrest, motor dysfunction and impaired Ca2+-evoked neurotransmitter release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik A G 5: 114,946,053 D76G probably benign Het
Abcg1 T C 17: 31,104,158 V237A probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Akap11 A T 14: 78,515,066 H122Q Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Arhgef4 C T 1: 34,724,437 R925W possibly damaging Het
Arid1a C T 4: 133,753,070 G181D probably damaging Het
Ash1l T A 3: 89,052,857 S2299T probably benign Het
Atf7ip C T 6: 136,561,064 Q432* probably null Het
B430306N03Rik T A 17: 48,316,455 S10T probably benign Het
Bckdk A G 7: 127,906,367 I221V probably benign Het
Brinp2 T C 1: 158,246,487 Y688C probably damaging Het
Caml C T 13: 55,631,971 L286F probably benign Het
Ccdc125 C T 13: 100,669,823 probably benign Het
Cdh24 A T 14: 54,639,020 V116E possibly damaging Het
Cenpe T A 3: 135,223,250 I305N probably damaging Het
Cep41 C T 6: 30,680,131 G33S probably damaging Het
Clec4b2 A T 6: 123,204,189 I178L probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dapk1 T A 13: 60,761,563 L1330Q probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fmnl1 G T 11: 103,171,158 probably benign Het
Galk1 A G 11: 116,012,609 F24L possibly damaging Het
Hyal4 T A 6: 24,755,786 M1K probably null Het
Ighe T C 12: 113,273,057 T64A Het
Iqch A G 9: 63,524,946 I389T possibly damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kdm1b T C 13: 47,077,446 S650P probably benign Het
Mapkapk5 T G 5: 121,525,713 N426T possibly damaging Het
Mroh5 G T 15: 73,792,765 Y90* probably null Het
Ncan T G 8: 70,097,575 I1184L probably benign Het
Nectin3 T C 16: 46,396,121 T439A probably benign Het
Neo1 G T 9: 58,990,193 A160E probably damaging Het
Nosip T C 7: 45,077,360 S295P possibly damaging Het
Nup205 T A 6: 35,245,339 F1979L probably benign Het
Nxpe2 A T 9: 48,319,868 D400E probably damaging Het
Olfr1246 T A 2: 89,590,987 I43F probably damaging Het
Pfkfb4 G A 9: 109,025,111 R351Q probably damaging Het
Psg29 T C 7: 17,210,537 I324T probably benign Het
Ptprh G T 7: 4,580,888 T235N possibly damaging Het
Ralgapa2 T A 2: 146,388,561 N981I possibly damaging Het
Ralgps1 T C 2: 33,146,639 Y421C probably damaging Het
Sf3b3 T C 8: 110,816,290 E845G possibly damaging Het
Sgk1 G T 10: 21,994,155 S31I probably benign Het
Sim1 T G 10: 50,981,323 Y390D probably damaging Het
Slain2 T A 5: 72,955,436 Y271* probably null Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Stab1 A T 14: 31,159,633 probably null Het
Supv3l1 A T 10: 62,449,423 L88Q probably damaging Het
Tpr C T 1: 150,403,887 R256C probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Usp32 A G 11: 85,022,808 I899T probably damaging Het
Usp6nl G T 2: 6,408,951 R96M probably damaging Het
Vmn1r75 A G 7: 11,881,034 D231G probably benign Het
Vmn2r42 T C 7: 8,194,873 E249G probably benign Het
Zbtb34 C T 2: 33,411,519 G337R probably benign Het
Zfp457 T A 13: 67,293,818 H231L probably benign Het
Zfp715 C T 7: 43,299,897 G213D possibly damaging Het
Zfp760 T G 17: 21,722,103 H86Q probably benign Het
Other mutations in Syt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Syt2 APN 1 134745815 missense probably benign 0.07
IGL02476:Syt2 APN 1 134747631 missense probably benign 0.01
IGL02487:Syt2 APN 1 134740865 missense probably damaging 0.99
IGL02524:Syt2 APN 1 134741965 missense probably benign
IGL02611:Syt2 APN 1 134741882 missense possibly damaging 0.90
IGL03173:Syt2 APN 1 134743579 missense possibly damaging 0.81
IGL03303:Syt2 APN 1 134741911 missense probably benign 0.44
kringle UTSW 1 134747620 missense probably damaging 1.00
R1661:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R1665:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R2049:Syt2 UTSW 1 134746741 splice site probably benign
R2130:Syt2 UTSW 1 134746741 splice site probably benign
R2141:Syt2 UTSW 1 134746741 splice site probably benign
R3154:Syt2 UTSW 1 134741861 missense possibly damaging 0.95
R5392:Syt2 UTSW 1 134744021 missense probably damaging 1.00
R5431:Syt2 UTSW 1 134740957 missense probably benign 0.03
R6065:Syt2 UTSW 1 134747557 missense probably benign 0.00
R6381:Syt2 UTSW 1 134746850 missense probably damaging 1.00
R6816:Syt2 UTSW 1 134745800 missense probably damaging 1.00
R6923:Syt2 UTSW 1 134746763 missense possibly damaging 0.76
R7002:Syt2 UTSW 1 134744104 missense probably damaging 1.00
R7994:Syt2 UTSW 1 134747592 missense possibly damaging 0.75
R8410:Syt2 UTSW 1 134746864 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ACAGAAGGGCAGATGCATTC -3'
(R):5'- CTTCAGCTTGGCGAACATG -3'

Sequencing Primer
(F):5'- AGCTGTCTTCAGACGCTTCAGAAG -3'
(R):5'- AGCTTGGCGAACATGTCTTC -3'
Posted On2020-11-02