Mutagenetix > Incidental Mutation

Incidental Mutation 'R8207:Fryl'

656400

Institutional Source

Beutler Lab

Gene Symbol

Fryl

Ensembl Gene

ENSMUSG00000070733

Gene Name

FRY like transcription coactivator

Synonyms

2510002A14Rik, 2310004H21Rik, 9030227G01Rik

MMRRC Submission

067630-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.794) question?

Stock #

R8207 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73019987-73256619 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to C at 73100500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000098687 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000094700

SMART Domains

Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	117	649	5.7e-176	PFAM
low complexity region	873	884	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	896	1141	1.3e-5	PFAM
Pfam:MOR2-PAG1_mid	1145	1331	2e-19	PFAM
Pfam:MOR2-PAG1_mid	1351	1450	1.2e-5	PFAM
low complexity region	1476	1487	N/A	INTRINSIC
low complexity region	1530	1548	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1590	1660	1.1e-5	PFAM
Pfam:MOR2-PAG1_mid	1725	1866	3.2e-15	PFAM
low complexity region	1973	1984	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	2002	2255	9.9e-78	PFAM
low complexity region	2329	2341	N/A	INTRINSIC
low complexity region	2473	2482	N/A	INTRINSIC
low complexity region	2485	2500	N/A	INTRINSIC
low complexity region	2523	2534	N/A	INTRINSIC
coiled coil region	2625	2649	N/A	INTRINSIC
low complexity region	2827	2841	N/A	INTRINSIC
coiled coil region	2854	2893	N/A	INTRINSIC
coiled coil region	2963	2989	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000101127

SMART Domains

Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	116	649	3e-172	PFAM
low complexity region	873	884	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	898	1115	7.8e-6	PFAM
Pfam:MOR2-PAG1_mid	1147	1331	9.5e-19	PFAM
Pfam:MOR2-PAG1_mid	1351	1503	1.1e-5	PFAM
low complexity region	1530	1548	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1589	1664	6e-6	PFAM
Pfam:MOR2-PAG1_mid	1725	1866	1.6e-14	PFAM
low complexity region	1973	1984	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	1998	2260	4.4e-76	PFAM
low complexity region	2329	2341	N/A	INTRINSIC
low complexity region	2473	2482	N/A	INTRINSIC
low complexity region	2485	2500	N/A	INTRINSIC
low complexity region	2523	2534	N/A	INTRINSIC
coiled coil region	2625	2649	N/A	INTRINSIC
low complexity region	2827	2841	N/A	INTRINSIC
coiled coil region	2854	2893	N/A	INTRINSIC
coiled coil region	2963	2989	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201405

SMART Domains

Protein: ENSMUSP00000144346
Gene: ENSMUSG00000070733

Domain	Start	End	E-Value	Type
low complexity region	103	114	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (49/49)

MGI Phenotype

PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	T	A	9: 92,351,008	F61L	probably benign	Het
Aen	G	A	7: 78,902,743	M150I	possibly damaging	Het
Arhgef11	A	G	3: 87,698,775	N279S	possibly damaging	Het
Arid3a	T	C	10: 79,950,926		probably null	Het
Casp8ap2	A	G	4: 32,646,446	T1840A	possibly damaging	Het
Ccdc14	T	A	16: 34,705,043	N235K	possibly damaging	Het
Cdh7	T	C	1: 109,994,346	V56A	probably damaging	Het
Clec16a	A	G	16: 10,627,448	N518S	probably benign	Het
Clec16a	G	A	16: 10,694,710	R837H	probably damaging	Het
Cog7	T	C	7: 121,977,292	D137G	possibly damaging	Het
Cpt1b	T	C	15: 89,418,815	T649A	probably damaging	Het
Efcab8	C	G	2: 153,789,225	L192V	probably damaging	Het
Farp2	A	G	1: 93,621,243	R1024G	probably benign	Het
Flvcr2	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Fmo1	T	A	1: 162,850,107	T147S	probably benign	Het
Galnt13	A	C	2: 54,880,110	I305L	probably benign	Het
Guca2a	A	G	4: 119,637,754	N2D	unknown	Het
Iqcd	C	T	5: 120,602,449	R282W	probably damaging	Het
Lamc1	A	C	1: 153,250,522	C475G	probably damaging	Het
Map3k5	AAAAGAAAAAGA	AA	10: 20,110,866		probably null	Het
Med13	A	T	11: 86,303,549	D789E	probably damaging	Het
Mn1	A	G	5: 111,421,785	Y1207C	probably damaging	Het
Mroh2b	A	G	15: 4,938,410	D977G	possibly damaging	Het
Mrpl53	A	T	6: 83,109,188	N26I	probably damaging	Het
Nell1	A	T	7: 50,220,012		probably null	Het
Ogdh	T	G	11: 6,349,329	F743V	probably benign	Het
Olfr1424	A	T	19: 12,058,858	M298K	possibly damaging	Het
Olfr732	C	T	14: 50,281,579	V225I	probably benign	Het
Olfr788	A	G	10: 129,473,084	T131A	probably benign	Het
Pmvk	A	G	3: 89,468,592	E174G	probably benign	Het
Pou6f2	T	C	13: 18,239,573	N206D		Het
Prelid3a	A	T	18: 67,472,948	S42C	probably benign	Het
Riok1	T	A	13: 38,052,320	H347Q	probably damaging	Het
Ryr1	A	G	7: 29,090,225	L1488P	probably damaging	Het
Shkbp1	A	G	7: 27,352,684	V158A	probably benign	Het
Slc9c1	A	G	16: 45,539,713	I43M	possibly damaging	Het
Smarca2	A	G	19: 26,676,680	N755S	possibly damaging	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tfb2m	G	A	1: 179,546,103	P10L	probably benign	Het
Trim30c	T	C	7: 104,383,496	M252V	probably benign	Het
Ttll1	A	G	15: 83,500,078	L116P	probably damaging	Het
Tubd1	C	T	11: 86,549,422	H91Y	possibly damaging	Het
Vgll4	A	G	6: 114,862,825	S175P	probably damaging	Het
Vmn1r79	A	G	7: 12,176,488	Y99C	possibly damaging	Het
Vmn2r80	C	T	10: 79,194,316	Q659*	probably null	Het
Zfp382	A	G	7: 30,134,415	D497G	possibly damaging	Het
Zfp41	A	G	15: 75,618,535	E112G	probably damaging	Het
Zfyve26	A	G	12: 79,260,831	S1754P	probably damaging	Het

Other mutations in Fryl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Fryl	APN	5	73148108	missense	possibly damaging	0.92
IGL01518:Fryl	APN	5	73086962	missense	possibly damaging	0.76
IGL01545:Fryl	APN	5	73054597	missense	probably damaging	1.00
IGL01646:Fryl	APN	5	73022501	critical splice donor site	probably null
IGL01938:Fryl	APN	5	73122364	missense	probably damaging	0.98
IGL01962:Fryl	APN	5	73032791	missense	possibly damaging	0.62
IGL02064:Fryl	APN	5	73124769	unclassified	probably benign
IGL02148:Fryl	APN	5	73075959	missense	probably benign	0.35
IGL02418:Fryl	APN	5	73110176	splice site	probably benign
IGL02431:Fryl	APN	5	73098308	missense	probably benign	0.02
IGL02513:Fryl	APN	5	73065293	missense	probably damaging	1.00
IGL02557:Fryl	APN	5	73098393	missense	probably damaging	1.00
IGL02625:Fryl	APN	5	73069877	intron	probably benign
IGL02642:Fryl	APN	5	73095466	missense	probably benign
IGL02657:Fryl	APN	5	73054860	missense	probably benign	0.01
IGL02706:Fryl	APN	5	73093163	missense	probably benign	0.45
IGL03022:Fryl	APN	5	73059383	missense	possibly damaging	0.82
IGL03144:Fryl	APN	5	73101455	missense	probably null	0.22
IGL03155:Fryl	APN	5	73076695	missense	probably benign
IGL03183:Fryl	APN	5	73076695	missense	probably benign
IGL03275:Fryl	APN	5	73148033	missense	possibly damaging	0.47
IGL03310:Fryl	APN	5	73136316	splice site	probably benign
IGL03341:Fryl	APN	5	73076695	missense	probably benign
IGL03343:Fryl	APN	5	73076695	missense	probably benign
IGL03350:Fryl	APN	5	73133306	missense	probably damaging	0.99
IGL03357:Fryl	APN	5	73054059	missense	probably damaging	1.00
IGL03374:Fryl	APN	5	73110281	splice site	probably benign
IGL03375:Fryl	APN	5	73088449	missense	possibly damaging	0.91
bedeviled	UTSW	5	73059500	missense	probably damaging	1.00
Besotted	UTSW	5	73072912	missense	probably damaging	1.00
R0062:Fryl	UTSW	5	73022278	missense	probably benign	0.02
R0062:Fryl	UTSW	5	73022278	missense	probably benign	0.02
R0308:Fryl	UTSW	5	73041604	splice site	probably benign
R0312:Fryl	UTSW	5	73072888	missense	probably damaging	1.00
R0415:Fryl	UTSW	5	73098414	missense	probably damaging	0.99
R0440:Fryl	UTSW	5	73086972	missense	possibly damaging	0.91
R0446:Fryl	UTSW	5	73097417	missense	possibly damaging	0.91
R0566:Fryl	UTSW	5	73064497	splice site	probably benign
R0567:Fryl	UTSW	5	73065391	missense	possibly damaging	0.50
R0606:Fryl	UTSW	5	73124734	missense	probably benign	0.15
R0619:Fryl	UTSW	5	73068731	missense	probably benign	0.22
R0654:Fryl	UTSW	5	73083372	missense	probably benign	0.17
R0658:Fryl	UTSW	5	73065359	missense	probably damaging	1.00
R0707:Fryl	UTSW	5	73083372	missense	probably benign	0.17
R0744:Fryl	UTSW	5	73089081	unclassified	probably benign
R0745:Fryl	UTSW	5	73071126	missense	probably damaging	0.96
R0833:Fryl	UTSW	5	73089081	unclassified	probably benign
R0885:Fryl	UTSW	5	73089196	missense	probably damaging	0.97
R0894:Fryl	UTSW	5	73041332	splice site	probably benign
R1076:Fryl	UTSW	5	73124673	unclassified	probably benign
R1241:Fryl	UTSW	5	73064925	splice site	probably benign
R1241:Fryl	UTSW	5	73110271	missense	probably damaging	1.00
R1394:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R1395:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R1608:Fryl	UTSW	5	73074751	nonsense	probably null
R1664:Fryl	UTSW	5	73059435	missense	probably damaging	1.00
R1745:Fryl	UTSW	5	73032861	splice site	probably benign
R1937:Fryl	UTSW	5	73133367	missense	probably damaging	1.00
R1969:Fryl	UTSW	5	73098266	missense	probably benign	0.18
R1993:Fryl	UTSW	5	73108493	missense	probably damaging	1.00
R1994:Fryl	UTSW	5	73108493	missense	probably damaging	1.00
R2029:Fryl	UTSW	5	73022122	nonsense	probably null
R2036:Fryl	UTSW	5	73022544	missense	probably benign
R2036:Fryl	UTSW	5	73107962	critical splice donor site	probably null
R2088:Fryl	UTSW	5	73065461	missense	probably benign	0.02
R2105:Fryl	UTSW	5	73122299	missense	probably benign
R2106:Fryl	UTSW	5	73098331	missense	probably damaging	1.00
R2186:Fryl	UTSW	5	73064975	missense	probably damaging	1.00
R2239:Fryl	UTSW	5	73108547	missense	probably damaging	0.99
R2256:Fryl	UTSW	5	73072844	missense	possibly damaging	0.47
R2257:Fryl	UTSW	5	73072844	missense	possibly damaging	0.47
R2280:Fryl	UTSW	5	73041364	missense	possibly damaging	0.47
R2281:Fryl	UTSW	5	73041364	missense	possibly damaging	0.47
R2911:Fryl	UTSW	5	73050456	missense	probably damaging	0.99
R3019:Fryl	UTSW	5	73082850	missense	probably benign	0.01
R3416:Fryl	UTSW	5	73108074	missense	possibly damaging	0.84
R3783:Fryl	UTSW	5	73101476	missense	probably benign
R3787:Fryl	UTSW	5	73101476	missense	probably benign
R3837:Fryl	UTSW	5	73071265	missense	probably benign	0.03
R3969:Fryl	UTSW	5	73112423	missense	probably damaging	0.97
R4387:Fryl	UTSW	5	73086560	missense	possibly damaging	0.91
R4502:Fryl	UTSW	5	73088397	missense	probably damaging	1.00
R4658:Fryl	UTSW	5	73081053	missense	probably damaging	1.00
R4664:Fryl	UTSW	5	73090679	missense	possibly damaging	0.80
R4690:Fryl	UTSW	5	73100293	missense	probably benign
R4700:Fryl	UTSW	5	73065538	missense	possibly damaging	0.88
R4709:Fryl	UTSW	5	73080972	missense	probably benign	0.03
R4807:Fryl	UTSW	5	73041362	missense	probably benign	0.00
R4912:Fryl	UTSW	5	73068782	frame shift	probably null
R4948:Fryl	UTSW	5	73089130	missense	probably benign	0.08
R4959:Fryl	UTSW	5	73035058	missense	probably benign	0.00
R5062:Fryl	UTSW	5	73075893	missense	possibly damaging	0.89
R5067:Fryl	UTSW	5	73057755	missense	probably benign	0.13
R5071:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5072:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5073:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5074:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5139:Fryl	UTSW	5	73090718	missense	probably damaging	1.00
R5172:Fryl	UTSW	5	73101673	missense	possibly damaging	0.95
R5187:Fryl	UTSW	5	73086600	missense	possibly damaging	0.95
R5272:Fryl	UTSW	5	73065136	nonsense	probably null
R5275:Fryl	UTSW	5	73112791	missense	probably damaging	1.00
R5295:Fryl	UTSW	5	73112791	missense	probably damaging	1.00
R5344:Fryl	UTSW	5	73104774	missense	probably damaging	1.00
R5355:Fryl	UTSW	5	73073904	missense	probably damaging	1.00
R5716:Fryl	UTSW	5	73100465	missense	probably benign
R5778:Fryl	UTSW	5	73072778	missense	probably damaging	1.00
R5810:Fryl	UTSW	5	73090755	missense	probably benign	0.06
R5934:Fryl	UTSW	5	73090717	missense	probably damaging	1.00
R5948:Fryl	UTSW	5	73097372	critical splice donor site	probably null
R6005:Fryl	UTSW	5	73083295	missense	probably damaging	1.00
R6026:Fryl	UTSW	5	73099997	missense	probably benign	0.04
R6045:Fryl	UTSW	5	73118551	missense	probably damaging	0.99
R6185:Fryl	UTSW	5	73112788	missense	probably benign	0.43
R6247:Fryl	UTSW	5	73065481	missense	probably damaging	0.98
R6294:Fryl	UTSW	5	73191759	intron	probably benign
R6310:Fryl	UTSW	5	73191761	intron	probably benign
R6429:Fryl	UTSW	5	73090751	missense	possibly damaging	0.84
R6568:Fryl	UTSW	5	73059516	missense	probably damaging	1.00
R6636:Fryl	UTSW	5	73133312	missense	probably benign	0.01
R6664:Fryl	UTSW	5	73132481	missense	probably damaging	1.00
R6732:Fryl	UTSW	5	73054781	missense	probably damaging	1.00
R6750:Fryl	UTSW	5	73022232	missense	probably damaging	1.00
R6805:Fryl	UTSW	5	73065094	missense	probably benign	0.03
R6823:Fryl	UTSW	5	73065217	missense	probably damaging	0.99
R6855:Fryl	UTSW	5	73059500	missense	probably damaging	1.00
R6858:Fryl	UTSW	5	73065032	missense	probably damaging	1.00
R6868:Fryl	UTSW	5	73068803	missense	probably damaging	1.00
R6898:Fryl	UTSW	5	73022142	missense	probably damaging	0.96
R6908:Fryl	UTSW	5	73022211	missense	probably damaging	1.00
R6958:Fryl	UTSW	5	73073929	missense	possibly damaging	0.89
R6980:Fryl	UTSW	5	73050430	missense	probably benign	0.06
R7036:Fryl	UTSW	5	73055608	missense	probably benign	0.03
R7065:Fryl	UTSW	5	73090756	missense	probably damaging	0.96
R7097:Fryl	UTSW	5	73073908	missense	probably benign	0.31
R7171:Fryl	UTSW	5	73122310	missense	probably damaging	0.97
R7191:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R7207:Fryl	UTSW	5	73065095	missense	probably benign
R7236:Fryl	UTSW	5	73108478	missense	possibly damaging	0.66
R7334:Fryl	UTSW	5	73047496	splice site	probably null
R7425:Fryl	UTSW	5	73104748	missense	probably damaging	1.00
R7452:Fryl	UTSW	5	73023988	missense	probably damaging	1.00
R7479:Fryl	UTSW	5	73097561	missense	possibly damaging	0.71
R7535:Fryl	UTSW	5	73098196	missense	probably benign	0.15
R7538:Fryl	UTSW	5	73022676	missense	probably benign	0.09
R7544:Fryl	UTSW	5	73081039	missense	probably benign
R7548:Fryl	UTSW	5	73191762	missense	unknown
R7565:Fryl	UTSW	5	73033720	missense	probably benign	0.18
R7572:Fryl	UTSW	5	73088396	missense	possibly damaging	0.91
R7582:Fryl	UTSW	5	73022500	critical splice donor site	probably null
R7630:Fryl	UTSW	5	73110245	missense	possibly damaging	0.62
R7774:Fryl	UTSW	5	73083384	missense	probably benign	0.12
R7777:Fryl	UTSW	5	73071298	missense	probably damaging	0.98
R7917:Fryl	UTSW	5	73054532	missense	probably damaging	1.00
R7920:Fryl	UTSW	5	73101807	splice site	probably null
R8110:Fryl	UTSW	5	73133277	missense	probably benign	0.10
R8120:Fryl	UTSW	5	73071184	missense	probably benign	0.01
R8143:Fryl	UTSW	5	73050339	missense	probably benign	0.00
R8263:Fryl	UTSW	5	73081005	missense	probably damaging	1.00
R8350:Fryl	UTSW	5	73068730	missense	probably benign
R8359:Fryl	UTSW	5	73075933	missense	probably benign	0.39
R8387:Fryl	UTSW	5	73136320	critical splice donor site	probably null
R8403:Fryl	UTSW	5	73118447	makesense	probably null
R8450:Fryl	UTSW	5	73068730	missense	probably benign
R8514:Fryl	UTSW	5	73085356	missense	probably benign
R8536:Fryl	UTSW	5	73100353	missense	probably damaging	0.99
R8703:Fryl	UTSW	5	73090654	missense	probably damaging	0.99
R8708:Fryl	UTSW	5	73132562	missense	probably benign	0.01
R8783:Fryl	UTSW	5	73068842	missense	probably benign	0.45
R9028:Fryl	UTSW	5	73098266	missense	probably benign	0.18
R9045:Fryl	UTSW	5	73024775	missense
R9063:Fryl	UTSW	5	73081003	missense	possibly damaging	0.70
R9096:Fryl	UTSW	5	73108577	missense	probably benign	0.01
R9244:Fryl	UTSW	5	73191519	intron	probably benign
R9345:Fryl	UTSW	5	73050411	missense	probably benign
R9381:Fryl	UTSW	5	73083294	missense	probably benign	0.24
R9386:Fryl	UTSW	5	73191809	missense	unknown
R9401:Fryl	UTSW	5	73065220	nonsense	probably null
R9497:Fryl	UTSW	5	73057791	missense
R9514:Fryl	UTSW	5	73104772	missense	probably damaging	1.00
R9570:Fryl	UTSW	5	73022155	missense	probably benign	0.02
R9654:Fryl	UTSW	5	73118458	missense	probably benign
R9665:Fryl	UTSW	5	73064956	missense	probably damaging	1.00
R9685:Fryl	UTSW	5	73059536	missense	probably damaging	0.99
R9798:Fryl	UTSW	5	73035059	missense	probably benign
Z1088:Fryl	UTSW	5	73090709	missense	probably damaging	0.99
Z1088:Fryl	UTSW	5	73090738	missense	probably damaging	1.00
Z1176:Fryl	UTSW	5	73072837	missense	probably benign
Z1177:Fryl	UTSW	5	73041595	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TATCTCTCGAAGGACGCTGAC -3'
(R):5'- TCAGTTGCGCTTTGAGCCTC -3'

Sequencing Primer
(F):5'- GACTGCCAGTCTTCTCGTGG -3'
(R):5'- CCTACACTGGTCTGAAACTTGAG -3'

Posted On

2020-11-04