Mutagenetix > Incidental Mutations

Incidental Mutation 'R8207:Nell1'

656401

Institutional Source

Beutler Lab

Gene Symbol

Nell1

Ensembl Gene

ENSMUSG00000055409

Gene Name

NEL-like 1

Synonyms

B230343H07Rik, l7R6

MMRRC Submission

Accession Numbers

Genbank: NM_001037906; MGI: 2443902

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8207 (G1)

Quality Score

59.0073

Status

Validated

Chromosome

Chromosomal Location

49974864-50866608 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 50220012 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081872] [ENSMUST00000107603] [ENSMUST00000151721]

Predicted Effect

probably null
Transcript: ENSMUST00000081872

SMART Domains

Protein: ENSMUSP00000080550
Gene: ENSMUSG00000055409

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TSPN	29	213	8.5e-72	SMART
LamG	81	208	1.77e-14	SMART
coiled coil region	240	266	N/A	INTRINSIC
VWC	273	331	1.45e-6	SMART
VWC	335	389	1.34e0	SMART
EGF	394	433	1.06e0	SMART
EGF_CA	434	475	7.93e-9	SMART
EGF	479	516	1.1e-2	SMART
EGF	518	547	8.32e-3	SMART
EGF_CA	549	595	1.08e-10	SMART
EGF_like	596	635	1.84e-4	SMART
VWC	634	686	1.42e0	SMART
VWC	694	749	1.83e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000107603

SMART Domains

Protein: ENSMUSP00000103229
Gene: ENSMUSG00000055409

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TSPN	29	213	8.5e-72	SMART
LamG	81	208	1.77e-14	SMART
coiled coil region	240	266	N/A	INTRINSIC
VWC	273	331	1.45e-6	SMART
VWC	335	389	1.34e0	SMART
EGF	394	433	1.06e0	SMART
EGF_CA	434	475	7.93e-9	SMART
EGF	479	516	1.1e-2	SMART
EGF	518	547	8.32e-3	SMART
EGF_like	549	588	1.84e-4	SMART
VWC	587	639	1.42e0	SMART
VWC	647	702	1.83e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000151721

SMART Domains

Protein: ENSMUSP00000114706
Gene: ENSMUSG00000055409

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TSPN	29	213	8.5e-72	SMART
LamG	81	208	1.77e-14	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (49/49)

MGI Phenotype

Strain: 3626314
Lethality: E19-E21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains epidermal growth factor (EGF)-like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynostosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mice display perinatal lethality, respiratory failure, impaired development of the intervertebral disks, vertebrae and calvarial bones, increased skull length, and abnormal curvature of the spine. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Gene trapped(2) Chemically induced(9)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	T	A	9: 92,351,008	F61L	probably benign	Het
Aen	G	A	7: 78,902,743	M150I	possibly damaging	Het
Arhgef11	A	G	3: 87,698,775	N279S	possibly damaging	Het
Arid3a	T	C	10: 79,950,926		probably null	Het
Casp8ap2	A	G	4: 32,646,446	T1840A	possibly damaging	Het
Ccdc14	T	A	16: 34,705,043	N235K	possibly damaging	Het
Cdh7	T	C	1: 109,994,346	V56A	probably damaging	Het
Clec16a	A	G	16: 10,627,448	N518S	probably benign	Het
Clec16a	G	A	16: 10,694,710	R837H	probably damaging	Het
Cog7	T	C	7: 121,977,292	D137G	possibly damaging	Het
Cpt1b	T	C	15: 89,418,815	T649A	probably damaging	Het
Efcab8	C	G	2: 153,789,225	L192V	probably damaging	Het
Farp2	A	G	1: 93,621,243	R1024G	probably benign	Het
Fmo1	T	A	1: 162,850,107	T147S	probably benign	Het
Fryl	A	C	5: 73,100,500		probably null	Het
Galnt13	A	C	2: 54,880,110	I305L	probably benign	Het
Guca2a	A	G	4: 119,637,754	N2D	unknown	Het
Iqcd	C	T	5: 120,602,449	R282W	probably damaging	Het
Lamc1	A	C	1: 153,250,522	C475G	probably damaging	Het
Map3k5	AAAAGAAAAAGA	AA	10: 20,110,866		probably null	Het
Med13	A	T	11: 86,303,549	D789E	probably damaging	Het
Mfsd7c	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Mn1	A	G	5: 111,421,785	Y1207C	probably damaging	Het
Mroh2b	A	G	15: 4,938,410	D977G	possibly damaging	Het
Mrpl53	A	T	6: 83,109,188	N26I	probably damaging	Het
Ogdh	T	G	11: 6,349,329	F743V	probably benign	Het
Olfr1424	A	T	19: 12,058,858	M298K	possibly damaging	Het
Olfr732	C	T	14: 50,281,579	V225I	probably benign	Het
Olfr788	A	G	10: 129,473,084	T131A	probably benign	Het
Pmvk	A	G	3: 89,468,592	E174G	probably benign	Het
Pou6f2	T	C	13: 18,239,573	N206D		Het
Riok1	T	A	13: 38,052,320	H347Q	probably damaging	Het
Ryr1	A	G	7: 29,090,225	L1488P	probably damaging	Het
Shkbp1	A	G	7: 27,352,684	V158A	probably benign	Het
Slc9c1	A	G	16: 45,539,713	I43M	possibly damaging	Het
Slmo1	A	T	18: 67,472,948	S42C	probably benign	Het
Smarca2	A	G	19: 26,676,680	N755S	possibly damaging	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tfb2m	G	A	1: 179,546,103	P10L	probably benign	Het
Trim30c	T	C	7: 104,383,496	M252V	probably benign	Het
Ttll1	A	G	15: 83,500,078	L116P	probably damaging	Het
Tubd1	C	T	11: 86,549,422	H91Y	possibly damaging	Het
Vgll4	A	G	6: 114,862,825	S175P	probably damaging	Het
Vmn1r79	A	G	7: 12,176,488	Y99C	possibly damaging	Het
Vmn2r80	C	T	10: 79,194,316	Q659*	probably null	Het
Zfp382	A	G	7: 30,134,415	D497G	possibly damaging	Het
Zfp41	A	G	15: 75,618,535	E112G	probably damaging	Het
Zfyve26	A	G	12: 79,260,831	S1754P	probably damaging	Het

Other mutations in Nell1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Nell1	APN	7	50120673	missense	probably damaging	0.96
IGL01434:Nell1	APN	7	50701208	missense	probably benign	0.01
IGL01796:Nell1	APN	7	50176216	splice site	probably benign
IGL02048:Nell1	APN	7	50219607	missense	probably damaging	0.96
IGL02239:Nell1	APN	7	50249650	missense	probably benign	0.08
IGL02860:Nell1	APN	7	50848485	missense	probably damaging	0.99
IGL02958:Nell1	APN	7	50220337	critical splice donor site	probably null
IGL03143:Nell1	APN	7	50279533	nonsense	probably null
IGL03334:Nell1	APN	7	50062611	splice site	probably null
D6062:Nell1	UTSW	7	50258191	missense	probably benign	0.21
P0018:Nell1	UTSW	7	50120691	missense	probably damaging	1.00
R0004:Nell1	UTSW	7	50560759	splice site	probably benign
R0029:Nell1	UTSW	7	50120715	splice site	probably benign
R0029:Nell1	UTSW	7	50120715	splice site	probably benign
R0468:Nell1	UTSW	7	50228846	missense	probably damaging	0.97
R0483:Nell1	UTSW	7	50230180	missense	probably benign	0.07
R0732:Nell1	UTSW	7	50856387	missense	probably damaging	1.00
R0945:Nell1	UTSW	7	50219585	missense	probably benign	0.07
R1022:Nell1	UTSW	7	50120663	missense	probably damaging	1.00
R1024:Nell1	UTSW	7	50120663	missense	probably damaging	1.00
R1075:Nell1	UTSW	7	50853840	missense	probably damaging	0.98
R1291:Nell1	UTSW	7	50230250	missense	probably benign	0.00
R1404:Nell1	UTSW	7	50853873	missense	possibly damaging	0.91
R1404:Nell1	UTSW	7	50853873	missense	possibly damaging	0.91
R1634:Nell1	UTSW	7	50848558	missense	possibly damaging	0.82
R1928:Nell1	UTSW	7	50701195	missense	possibly damaging	0.51
R2060:Nell1	UTSW	7	50560830	missense	possibly damaging	0.58
R2261:Nell1	UTSW	7	50560821	missense	possibly damaging	0.95
R2262:Nell1	UTSW	7	50560821	missense	possibly damaging	0.95
R2263:Nell1	UTSW	7	50560821	missense	possibly damaging	0.95
R2448:Nell1	UTSW	7	50856387	missense	probably damaging	1.00
R2869:Nell1	UTSW	7	50249657	intron	probably benign
R2870:Nell1	UTSW	7	50249657	intron	probably benign
R2871:Nell1	UTSW	7	50249657	intron	probably benign
R3498:Nell1	UTSW	7	50258179	missense	possibly damaging	0.55
R4044:Nell1	UTSW	7	50219619	missense	probably damaging	1.00
R4623:Nell1	UTSW	7	50120562	missense	possibly damaging	0.84
R4732:Nell1	UTSW	7	50856217	missense	probably damaging	1.00
R4733:Nell1	UTSW	7	50856217	missense	probably damaging	1.00
R4941:Nell1	UTSW	7	50062638	missense	probably benign	0.10
R4942:Nell1	UTSW	7	50120649	missense	possibly damaging	0.84
R5233:Nell1	UTSW	7	50176314	missense	probably damaging	0.99
R5590:Nell1	UTSW	7	50279611	missense	probably damaging	1.00
R5673:Nell1	UTSW	7	50228846	missense	probably damaging	0.99
R5741:Nell1	UTSW	7	50560890	splice site	probably null
R6345:Nell1	UTSW	7	49975423	missense	possibly damaging	0.91
R6916:Nell1	UTSW	7	50701179	missense	probably benign	0.00
R7051:Nell1	UTSW	7	50448844	missense	unknown
R7302:Nell1	UTSW	7	50856269	missense	probably benign
R7339:Nell1	UTSW	7	50279549	missense	probably benign	0.01
R7831:Nell1	UTSW	7	49982800	missense	possibly damaging	0.85
R7913:Nell1	UTSW	7	50279522	missense	possibly damaging	0.93
R8094:Nell1	UTSW	7	50120587	missense	probably benign	0.02
R8191:Nell1	UTSW	7	50448874	missense	unknown
R8292:Nell1	UTSW	7	50258247	missense	probably damaging	1.00
R8340:Nell1	UTSW	7	50220273	missense	probably damaging	0.98
Z1176:Nell1	UTSW	7	50560882	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTTTGGCAATTACAATTTGAGGGC -3'
(R):5'- GTGTTAACCTTGTGCTCGCATG -3'

Sequencing Primer
(F):5'- CAAGAAAGGATCACACAATGGGTTC -3'
(R):5'- TAACCTTGTGCTCGCATGAGAGAG -3'

Posted On

2020-11-04